Transcript: Human NR_037805.1

Homo sapiens zinc finger protein 321, pseudogene (ZNF321P), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
ZNF321P (399669)
Length:
2334
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_037805.1
NBCI Gene record:
ZNF321P (399669)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_037805.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147524 GAGAGTGGCAAATCCTTTAAT pLKO.1 568 3UTR 100% 15.000 7.500 Y ZNF321P n/a
2 TRCN0000018107 GCTGGAAACAAGCCTATTAAA pLKO.1 303 3UTR 100% 15.000 7.500 Y ZNF600 n/a
3 TRCN0000147196 CGTCTCCAGTAAACATACAAA pLKO.1 2162 3UTR 100% 5.625 2.813 Y ZNF321P n/a
4 TRCN0000147302 GTCGCAAATCACATCTTGAAA pLKO.1 1007 3UTR 100% 5.625 2.813 Y ZNF321P n/a
5 TRCN0000148935 CAAGGGAGATAGTACCTGTAT pLKO.1 1567 3UTR 100% 4.950 2.475 Y ZNF321P n/a
6 TRCN0000142662 GCAAGGCAATACAGAAGTGAT pLKO.1 98 3UTR 100% 4.950 2.475 Y ZNF468 n/a
7 TRCN0000147979 GCAATTCATACTGGAGAGAAT pLKO.1 868 3UTR 100% 4.950 2.475 Y ZNF321P n/a
8 TRCN0000149463 GCACGTCATCATAGACTTCAT pLKO.1 940 3UTR 100% 4.950 2.475 Y ZNF321P n/a
9 TRCN0000150214 GTAATGAATGTGGCAAGGTTT pLKO.1 899 3UTR 100% 4.950 2.475 Y ZNF813 n/a
10 TRCN0000148307 CAATGTAATGAGAGTGGCAAA pLKO.1 559 3UTR 100% 4.050 2.025 Y ZNF321P n/a
11 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 2110 3UTR 100% 4.050 2.025 Y P3H4 n/a
12 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 2110 3UTR 100% 4.050 2.025 Y ORAI2 n/a
13 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 2110 3UTR 100% 4.050 2.025 Y P3H4 n/a
14 TRCN0000149102 GTAATGAGAGTGGCAAATCCT pLKO.1 563 3UTR 100% 3.000 1.500 Y ZNF321P n/a
15 TRCN0000147092 CCAGTAAACATACAAAGCCAT pLKO.1 2167 3UTR 100% 2.640 1.320 Y ZNF321P n/a
16 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1982 3UTR 100% 5.625 2.813 Y KLHL30 n/a
17 TRCN0000015885 GCAATTCATACTGGAGAGAAA pLKO.1 868 3UTR 100% 4.950 2.475 Y ZNF702P n/a
18 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 1294 3UTR 100% 2.640 1.320 Y LINC01098 n/a
19 TRCN0000149655 GCCCTTGTAATTCATAAGGCT pLKO.1 850 3UTR 100% 0.750 0.375 Y ZNF813 n/a
20 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1982 3UTR 100% 5.625 2.813 Y EID2B n/a
21 TRCN0000148611 CGTAGACTTCATACTGGAGAA pLKO.1 781 3UTR 100% 4.050 2.025 Y ZNF761 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_037805.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05629 pDONR223 100% 21% None 1_71del;564_2334del n/a
2 ccsbBroad304_05629 pLX_304 0% 21% V5 1_71del;564_2334del n/a
3 TRCN0000468214 TCTCTAGTACCTCAATAGGTGGTT pLX_317 94.7% 21% V5 1_71del;564_2334del n/a
4 ccsbBroadEn_13667 pDONR223 100% 4.6% None 1_486del;595_2334del n/a
5 ccsbBroad304_13667 pLX_304 0% 4.6% V5 1_486del;595_2334del n/a
6 TRCN0000471939 ATACCCTTCTTATTCAGAGCAATT pLX_317 100% 4.6% V5 1_486del;595_2334del n/a
Download CSV