Transcript: Human NR_044994.1

Homo sapiens CTAGE family member 7, pseudogene (CTAGE7P), non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
CTAGE7P (119437)
Length:
2830
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_044994.1
NBCI Gene record:
CTAGE7P (119437)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_044994.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337222 AGAGCTTACAGAGCATATTAA pLKO_005 1075 3UTR 100% 15.000 7.500 Y CTAGE9 n/a
2 TRCN0000337161 ATGAATTGATGGCGGATATTT pLKO_005 525 3UTR 100% 15.000 7.500 Y CTAGE9 n/a
3 TRCN0000159554 CCAAAGATGATCTTGGTAATT pLKO.1 2028 3UTR 100% 13.200 6.600 Y MIA2 n/a
4 TRCN0000161026 GAAGAGCTTACAGAGCATATT pLKO.1 1073 3UTR 100% 13.200 6.600 Y CTAGE4 n/a
5 TRCN0000337160 TCGGTTAGGAGTCGGCTTTAT pLKO_005 230 3UTR 100% 13.200 6.600 Y CTAGE9 n/a
6 TRCN0000160201 CCAAAGATCTTGAAGAAGAAT pLKO.1 1335 3UTR 100% 5.625 2.813 Y CTAGE4 n/a
7 TRCN0000005400 GCTGAAAGAAACCTCAATGAT pLKO.1 1439 3UTR 100% 5.625 2.813 Y CTAGE1 n/a
8 TRCN0000146679 CAATGCCTTCAGAAATGGAAT pLKO.1 1992 3UTR 100% 4.950 2.475 Y CTAGE6 n/a
9 TRCN0000158611 CAGATTATTTCCCATGAGAAA pLKO.1 1385 3UTR 100% 4.950 2.475 Y MIA2 n/a
10 TRCN0000158755 GAAATGAAACTCTACAGGAAA pLKO.1 1208 3UTR 100% 4.950 2.475 Y CTAGE4 n/a
11 TRCN0000158825 GCAGATTATTTCCCATGAGAA pLKO.1 1384 3UTR 100% 4.950 2.475 Y MIA2 n/a
12 TRCN0000161860 GCCAAAGATCTTGAAGAAGAA pLKO.1 1334 3UTR 100% 4.950 2.475 Y CTAGE4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_044994.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13076 pDONR223 100% 85.8% None (many diffs) n/a
2 ccsbBroad304_13076 pLX_304 0% 85.8% V5 (many diffs) n/a
3 TRCN0000481377 AACTAGAGAATGGGATCGGTCGAA pLX_317 19.7% 85.8% V5 (many diffs) n/a
4 ccsbBroadEn_10967 pDONR223 100% 78.7% None (many diffs) n/a
5 ccsbBroad304_10967 pLX_304 0% 78.7% V5 (many diffs) n/a
6 TRCN0000470328 CTTGCATGAATTTATTTTATTCTT pLX_317 13.8% 78.7% V5 (many diffs) n/a
7 ccsbBroadEn_03960 pDONR223 100% 72.1% None (many diffs) n/a
8 ccsbBroad304_03960 pLX_304 0% 72.1% V5 (many diffs) n/a
9 TRCN0000469836 CGAATATCTAATGCTCGTTTGACG pLX_317 17.1% 72.1% V5 (many diffs) n/a
10 ccsbBroadEn_10968 pDONR223 100% 71.2% None (many diffs) n/a
11 ccsbBroad304_10968 pLX_304 0% 71.2% V5 (many diffs) n/a
12 TRCN0000475416 ATAGTTAGCGCAGAAAAGATACGG pLX_317 11.5% 71.2% V5 (many diffs) n/a
13 ccsbBroadEn_13596 pDONR223 100% 69.4% None (many diffs) n/a
14 ccsbBroad304_13596 pLX_304 0% 69.4% V5 (many diffs) n/a
Download CSV