Transcript: Human NR_117087.1

Homo sapiens zinc finger protein 714 (ZNF714), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
ZNF714 (148206)
Length:
2733
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_117087.1
NBCI Gene record:
ZNF714 (148206)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_117087.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179291 GCCTTTAACAAGCCCTCAATT pLKO.1 2401 3UTR 100% 13.200 7.920 N ZNF714 n/a
2 TRCN0000146293 CCAATGTGAAGAATGTGACAA pLKO.1 897 3UTR 100% 4.950 2.970 N ZNF714 n/a
3 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1385 3UTR 100% 13.200 6.600 Y Zfp934 n/a
4 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1385 3UTR 100% 13.200 6.600 Y 2810408B13Rik n/a
5 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1385 3UTR 100% 13.200 6.600 Y EG668616 n/a
6 TRCN0000256745 CAGCCTGGCCAACATGGTAAA pLKO_005 1969 3UTR 100% 10.800 5.400 Y SMIM11A n/a
7 TRCN0000018499 CTGGTCTTCTTGGCAGGTATT pLKO.1 409 3UTR 100% 10.800 5.400 Y ZNF493 n/a
8 TRCN0000419715 TGGTCTTCTTGGCAGGTATTG pLKO_005 410 3UTR 100% 10.800 5.400 Y ZNF430 n/a
9 TRCN0000016346 CACTGGAGAGAAACCCTACAA pLKO.1 1719 3UTR 100% 4.950 2.475 Y ZNF254 n/a
10 TRCN0000183765 CCCTCAATTCTTAACAGACAT pLKO.1 2413 3UTR 100% 4.950 2.475 Y ZNF714 n/a
11 TRCN0000146802 CCTCAAACCTTACTACACATA pLKO.1 1688 3UTR 100% 4.950 2.475 Y ZNF714 n/a
12 TRCN0000149073 GCAAAGCCTTTAACCAGTCTT pLKO.1 2313 3UTR 100% 4.950 2.475 Y ZNF714 n/a
13 TRCN0000149336 GCAAAGGCTTTAACTGGTCTT pLKO.1 1334 3UTR 100% 4.050 2.025 Y ZNF714 n/a
14 TRCN0000236731 ACCTTACTACACATAAGATAA pLKO_005 1442 3UTR 100% 13.200 6.600 Y ZNF98 n/a
15 TRCN0000236730 CCCTTACTACACATAAGATAA pLKO_005 1022 3UTR 100% 13.200 6.600 Y ZNF98 n/a
16 TRCN0000017701 CCAGTCTTCAACTCTTACTAA pLKO.1 2326 3UTR 100% 5.625 2.813 Y ZNF430 n/a
17 TRCN0000015887 GTGAAGAATGTGACAAAGTTT pLKO.1 902 3UTR 100% 5.625 2.813 Y ZNF702P n/a
18 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 2618 3UTR 100% 4.950 2.475 Y CFLAR n/a
19 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 2618 3UTR 100% 4.950 2.475 Y C19orf31 n/a
20 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 1558 3UTR 100% 4.950 2.475 Y ZNF28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_117087.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09784 pDONR223 100% 58.8% None (many diffs) n/a
2 ccsbBroad304_09784 pLX_304 0% 58.8% V5 (many diffs) n/a
3 TRCN0000478115 ATTTTTATATATACCACTCGGCCC pLX_317 19.7% 58.8% V5 (many diffs) n/a
4 ccsbBroadEn_15167 pDONR223 53.6% 54.6% None (many diffs) n/a
5 ccsbBroad304_15167 pLX_304 0% 54.6% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_15273 pDONR223 50.9% 50.9% None (many diffs) n/a
7 ccsbBroad304_15273 pLX_304 0% 50.9% V5 (many diffs) n/a
8 TRCN0000472761 GCGGTTCAATGTTGTAGTCTTGTG pLX_317 63.8% 24.6% V5 (not translated due to frame shift) (many diffs) n/a
9 ccsbBroadEn_11384 pDONR223 100% 8.9% None (many diffs) n/a
10 ccsbBroad304_11384 pLX_304 0% 8.9% V5 (many diffs) n/a
11 TRCN0000470576 TACATACAGACCTACACGTAGACC pLX_317 100% 8.9% V5 (many diffs) n/a
12 ccsbBroadEn_13746 pDONR223 100% 7.4% None (many diffs) n/a
13 ccsbBroad304_13746 pLX_304 0% 7.4% V5 (many diffs) n/a
14 TRCN0000475669 ATTCGCAGCGAGTTTGTCCGCCGC pLX_317 100% 7.4% V5 (many diffs) n/a
Download CSV