Transcript: Human NR_132997.1

Homo sapiens LINC00680-GUSBP4 readthrough (LINC00680-GUSBP4), transcript variant 1, non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
LINC00680-GUSBP4 (106660613)
Length:
1029
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_132997.1
NBCI Gene record:
LINC00680-GUSBP4 (106660613)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_132997.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147118 CCAGTTTGAGAATTGGTGTAA pLKO.1 908 3UTR 100% 4.950 2.475 Y GUSBP1 n/a
2 TRCN0000063784 CTACTCTTGGTATCGCAACTA pLKO.1 851 3UTR 100% 4.950 2.475 Y GUSBP14 n/a
3 TRCN0000063785 GATCCGTGTGAACAGCTACTA pLKO.1 833 3UTR 100% 4.950 2.475 Y GUSBP14 n/a
4 TRCN0000140371 GATCCGTGTGAACAGCTACTA pLKO.1 833 3UTR 100% 4.950 2.475 Y GUSBP15 n/a
5 TRCN0000155518 GATCCGTGTGAACAGCTACTA pLKO.1 833 3UTR 100% 4.950 2.475 Y GUSBP2 n/a
6 TRCN0000159442 GCAATGTTTGAACAAACTCAA pLKO.1 229 3UTR 100% 4.950 2.475 Y GUSBP4 n/a
7 TRCN0000063787 TCAAGTTGGAAGTGTGTCTTT pLKO.1 585 3UTR 100% 4.950 2.475 Y GUSBP14 n/a
8 TRCN0000083212 TGTGGATGTGATCCGTGTGAA pLKO.1 824 3UTR 100% 4.950 2.475 Y GUSBP14 n/a
9 TRCN0000083208 CCCATTATTCAGAGCGCGTAT pLKO.1 940 3UTR 100% 4.050 2.025 Y GUSBP14 n/a
10 TRCN0000180084 CCCATTATTCAGAGCGCGTAT pLKO.1 940 3UTR 100% 4.050 2.025 Y GUSBP1 n/a
11 TRCN0000147980 GTAAGACATCACAATCCCATT pLKO.1 925 3UTR 100% 4.050 2.025 Y GUSBP1 n/a
12 TRCN0000151124 GTAAGACATCACAATCCCATT pLKO.1 925 3UTR 100% 4.050 2.025 Y GUSBP2 n/a
13 TRCN0000139692 CGTGTGAACAGCTACTACTCT pLKO.1 837 3UTR 100% 3.000 1.500 Y GUSBP15 n/a
14 TRCN0000142395 GAACAGCTACTACTCTTGGTA pLKO.1 842 3UTR 100% 3.000 1.500 Y GUSBP15 n/a
15 TRCN0000160896 GCTCACACATTTGACTTGGAA pLKO.1 208 3UTR 100% 3.000 1.500 Y GUSBP4 n/a
16 TRCN0000063786 GATTGCTCACACCAAAGCCTT pLKO.1 737 3UTR 100% 2.640 1.320 Y GUSBP14 n/a
17 TRCN0000140607 GATTGCTCACACCAAAGCCTT pLKO.1 737 3UTR 100% 2.640 1.320 Y GUSBP15 n/a
18 TRCN0000155293 GATTGCTCACACCAAAGCCTT pLKO.1 737 3UTR 100% 2.640 1.320 Y GUSBP2 n/a
19 TRCN0000139985 GCTACTACTCTTGGTATCGCA pLKO.1 847 3UTR 100% 0.750 0.375 Y GUSBP15 n/a
20 TRCN0000083211 GATGGTGATTGCTCACACCAA pLKO.1 731 3UTR 100% 0.264 0.132 Y GUSBP14 n/a
21 TRCN0000140710 GATGGTGATTGCTCACACCAA pLKO.1 731 3UTR 100% 0.264 0.132 Y GUSBP15 n/a
22 TRCN0000154457 GATGGTGATTGCTCACACCAA pLKO.1 731 3UTR 100% 0.264 0.132 Y GUSBP2 n/a
23 TRCN0000155750 CGTATGGAGTGGAAACGCTTA pLKO.1 956 3UTR 100% 4.050 2.025 Y GUSBP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_132997.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10363 pDONR223 100% 37.7% None (many diffs) n/a
2 ccsbBroad304_10363 pLX_304 0% 37.7% V5 (many diffs) n/a
3 TRCN0000468935 ACAAATCCACAGGGATACGTAGGA pLX_317 82.2% 37.7% V5 (many diffs) n/a
4 TRCN0000465895 CCTGACATAGAGGTGGGACTACAG pLX_317 77.6% 37.7% V5 (many diffs) n/a
5 TRCN0000480097 CCTACCAATTATGTCCTACTGCCC pLX_317 90.5% 37.7% V5 (many diffs) n/a
6 ccsbBroadEn_14986 pDONR223 97.2% 37.5% None (many diffs) n/a
7 ccsbBroad304_14986 pLX_304 0% 37.5% V5 (many diffs) n/a
8 ccsbBroadEn_13733 pDONR223 100% 26.7% None (many diffs) n/a
9 ccsbBroad304_13733 pLX_304 0% 26.7% V5 (many diffs) n/a
10 TRCN0000466397 GCGGGGGCGTGTGCCAGAGAATTC pLX_317 100% 26.7% V5 (many diffs) n/a
11 ccsbBroadEn_13642 pDONR223 100% 26.6% None (many diffs) n/a
12 ccsbBroad304_13642 pLX_304 0% 26.6% V5 (many diffs) n/a
13 TRCN0000466500 GCTTTGTGTAGGTATACCCTTCGC pLX_317 100% 26.6% V5 (many diffs) n/a
14 ccsbBroadEn_10410 pDONR223 100% 25.1% None (many diffs) n/a
15 ccsbBroad304_10410 pLX_304 0% 25.1% V5 (many diffs) n/a
16 TRCN0000468931 TTGATACAAGTTGGTTCCTGGCAG pLX_317 100% 25.1% V5 (many diffs) n/a
Download CSV