Transcript: Human NR_135106.1

Homo sapiens S100P binding protein (S100PBP), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
S100PBP (64766)
Length:
4269
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135106.1
NBCI Gene record:
S100PBP (64766)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135106.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149735 GTGGTTCACACAAGTCAAGTT pLKO.1 889 3UTR 100% 4.950 6.930 N S100PBP n/a
2 TRCN0000276101 GTAACTGTTGCACCATTTAAT pLKO_005 555 3UTR 100% 15.000 10.500 N S100PBP n/a
3 TRCN0000276100 CATGGACCAGCTCATACTAAA pLKO_005 492 3UTR 100% 13.200 9.240 N S100PBP n/a
4 TRCN0000128004 GAACAGCAGAAGCAGCTTTAT pLKO.1 1071 3UTR 100% 13.200 9.240 N S100PBP n/a
5 TRCN0000276102 GAACAGCAGAAGCAGCTTTAT pLKO_005 1071 3UTR 100% 13.200 9.240 N S100PBP n/a
6 TRCN0000276099 TAACTTGTGAATGGATATAAG pLKO_005 1851 3UTR 100% 13.200 9.240 N S100PBP n/a
7 TRCN0000129313 CCATGAGAGAAGACTAGGCAA pLKO.1 986 3UTR 100% 2.640 1.848 N S100PBP n/a
8 TRCN0000148221 GAGACTCCTAATATGGAGTTA pLKO.1 855 3UTR 100% 0.495 0.347 N S100PBP n/a
9 TRCN0000127743 GAGAAGACTAGGCAAAGTCAT pLKO.1 992 3UTR 100% 4.950 2.970 N S100PBP n/a
10 TRCN0000276168 GAGAAGACTAGGCAAAGTCAT pLKO_005 992 3UTR 100% 4.950 2.970 N S100PBP n/a
11 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 2839 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135106.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08866 pDONR223 100% 28.5% None (many diffs) n/a
2 ccsbBroad304_08866 pLX_304 0% 28.5% V5 (many diffs) n/a
3 TRCN0000466457 AACTACTTCACAGAAGCTGCCCAC pLX_317 20.8% 28.5% V5 (many diffs) n/a
4 ccsbBroadEn_10261 pDONR223 100% 1.5% None (many diffs) n/a
5 ccsbBroad304_10261 pLX_304 0% 1.5% V5 (many diffs) n/a
6 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% 1.5% V5 (many diffs) n/a
Download CSV