Transcript: Human NM_018923.2

Homo sapiens protocadherin gamma subfamily B, 2 (PCDHGB2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
PCDHGB2 (56103)
Length:
4602
CDS:
1..2796

Additional Resources:

NCBI RefSeq record:
NM_018923.2
NBCI Gene record:
PCDHGB2 (56103)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018923.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418058 AGACTCCAGATGGTCGTAAAT pLKO_005 551 CDS 100% 13.200 18.480 N PCDHGB2 n/a
2 TRCN0000433095 GTCCAGATCCGCTATTCAATT pLKO_005 91 CDS 100% 13.200 18.480 N PCDHGB2 n/a
3 TRCN0000056453 CCCGCTATTCAAACAGACTAA pLKO.1 390 CDS 100% 4.950 6.930 N PCDHGB2 n/a
4 TRCN0000056455 CGACAAAGGATGATTTGGATT pLKO.1 905 CDS 100% 4.950 3.960 N PCDHGB2 n/a
5 TRCN0000420756 CGATTGTGCACCTGAAGTTAT pLKO_005 1023 CDS 100% 13.200 9.240 N PCDHGB2 n/a
6 TRCN0000056454 GCAGTAATTGTGCAGGATATA pLKO.1 358 CDS 100% 13.200 9.240 N PCDHGB2 n/a
7 TRCN0000056456 CCAATTACAGTGAGGGTACAT pLKO.1 2222 CDS 100% 4.950 3.465 N PCDHGB2 n/a
8 TRCN0000056457 CCACCTTAATGACAACGAGTA pLKO.1 510 CDS 100% 4.050 2.430 N PCDHGB2 n/a
9 TRCN0000053813 CCAGCCATAAACCAATAACTA pLKO.1 3697 3UTR 100% 5.625 2.813 Y PCDHGA2 n/a
10 TRCN0000203363 CCCAAGATCAATGCTCAAGTT pLKO.1 3342 3UTR 100% 4.950 2.475 Y PCDHGA7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018923.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03700 pDONR223 100% 86.9% 86.6% None (many diffs) n/a
2 ccsbBroad304_03700 pLX_304 0% 86.9% 86.6% V5 (many diffs) n/a
3 TRCN0000477690 CCGGAGGTACTTTTCTAGTCAATA pLX_317 12.2% 86.9% 86.6% V5 (many diffs) n/a
4 ccsbBroadEn_01151 pDONR223 100% 14.2% 13.7% None (many diffs) n/a
5 ccsbBroad304_01151 pLX_304 0% 14.2% 13.7% V5 (many diffs) n/a
6 TRCN0000466539 CATGGTTCGGTAATGAAAGTTCCA pLX_317 36.4% 14.2% 13.7% V5 (many diffs) n/a
7 ccsbBroadEn_11019 pDONR223 100% 6.4% 6.4% None 1_2613del n/a
8 ccsbBroad304_11019 pLX_304 0% 6.4% 6.4% V5 1_2613del n/a
Download CSV