Transcript: Mouse NM_028966.3

Mus musculus sterile alpha motif domain containing 4 (Samd4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Samd4 (74480)
Length:
6856
CDS:
627..2498

Additional Resources:

NCBI RefSeq record:
NM_028966.3
NBCI Gene record:
Samd4 (74480)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028966.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219545 CGACGCGAAAGCAGAGTATAT pLKO.1 911 CDS 100% 13.200 18.480 N Samd4 n/a
2 TRCN0000219546 GATTATGGACAGACGCATTAC pLKO.1 1134 CDS 100% 10.800 8.640 N Samd4 n/a
3 TRCN0000217513 GTCTTGTTCATGAGGCATTTA pLKO.1 1924 CDS 100% 13.200 9.240 N Samd4 n/a
4 TRCN0000219547 AGACAGAACTCTGACGATAAG pLKO.1 1164 CDS 100% 10.800 7.560 N Samd4 n/a
5 TRCN0000116146 GCAACAGGAATCCAAGGATAA pLKO.1 839 CDS 100% 10.800 7.560 N SAMD4A n/a
6 TRCN0000288937 GCAACAGGAATCCAAGGATAA pLKO_005 839 CDS 100% 10.800 7.560 N SAMD4A n/a
7 TRCN0000179422 CCTCCAGCAAACTTTCAGATA pLKO.1 3055 3UTR 100% 4.950 3.465 N Samd4 n/a
8 TRCN0000184529 GCAGAAGCTCTTTCGGTCTTT pLKO.1 1988 CDS 100% 4.950 3.465 N Samd4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028966.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07831 pDONR223 100% 90.2% 94.2% None (many diffs) n/a
2 ccsbBroad304_07831 pLX_304 0% 90.2% 94.2% V5 (many diffs) n/a
3 TRCN0000491644 TAACATCATGGATAGATATGTGGT pLX_317 18.5% 90.2% 94.2% V5 (many diffs) n/a
4 ccsbBroadEn_15747 pDONR223 0% 40.8% 42.5% None (many diffs) n/a
5 ccsbBroad304_15747 pLX_304 0% 40.8% 42.5% V5 (many diffs) n/a
6 TRCN0000465896 TGGTACACAGTCATTTGCATACCT pLX_317 39.4% 40.8% 42.5% V5 (many diffs) n/a
7 ccsbBroadEn_11662 pDONR223 100% 36.5% 36.6% None (many diffs) n/a
8 ccsbBroad304_11662 pLX_304 0% 36.5% 36.6% V5 (many diffs) n/a
9 TRCN0000469313 GCGTCCTGTCCTACTGCTGGTGAC pLX_317 65% 36.5% 36.6% V5 (many diffs) n/a
Download CSV