Transcript: Human XM_011515550.1

PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II beta (CAMK2B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CAMK2B (816)
Length:
2324
CDS:
87..2144

Additional Resources:

NCBI RefSeq record:
XM_011515550.1
NBCI Gene record:
CAMK2B (816)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515550.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219642 TACCAGCTCTACGAGGATATT pLKO.1 126 CDS 100% 0.000 0.000 N CAMK2B n/a
2 TRCN0000000466 GACCAGATGTGATTTGTTAAA pLKO.1 2277 3UTR 100% 13.200 10.560 N CAMK2B n/a
3 TRCN0000195670 CCGGAAGCAGGAGATCATTAA pLKO.1 1742 CDS 100% 13.200 9.240 N CAMK2B n/a
4 TRCN0000219643 ATAGAGGATGAAGACGCTAAA pLKO.1 1218 CDS 100% 10.800 7.560 N CAMK2B n/a
5 TRCN0000000468 CTCAAACCACCGTCATCCATA pLKO.1 1150 CDS 100% 4.950 3.465 N CAMK2B n/a
6 TRCN0000000470 ATCTCTGACATCCTGAACTCT pLKO.1 1362 CDS 100% 3.000 2.100 N CAMK2B n/a
7 TRCN0000000467 GATCATTAAGACCACGGAGCA pLKO.1 1754 CDS 100% 2.160 1.512 N CAMK2B n/a
8 TRCN0000199243 CCTGAGGTCCTTCGCAAAGAG pLKO.1 633 CDS 100% 1.650 1.155 N CAMK2B n/a
9 TRCN0000199539 CGCATGTTTGTGTCTGCCTCG pLKO.1 2220 3UTR 100% 0.400 0.280 N CAMK2B n/a
10 TRCN0000000469 ACAAGAAAGCAGATGGAGTCA pLKO.1 1051 CDS 100% 2.640 1.584 N CAMK2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515550.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14563 pDONR223 93.6% 73.4% 73.4% None 1059_1103del;1152_1652del n/a
2 ccsbBroad304_14563 pLX_304 0% 73.4% 73.4% V5 1059_1103del;1152_1652del n/a
3 TRCN0000468031 AGCATTTCATGGTGGACCTTTAGT pLX_317 28.9% 70.5% 70.5% V5 (not translated due to frame shift) (many diffs) n/a
4 ccsbBroadEn_14564 pDONR223 0% 73.4% 73.4% None 1059_1103del;1152_1652del n/a
5 ccsbBroad304_14564 pLX_304 0% 73.4% 73.4% V5 1059_1103del;1152_1652del n/a
6 TRCN0000480225 GACAGTGGGGGTGATCTCGGAGCG pLX_317 22.3% 73.4% 73.4% V5 1059_1103del;1152_1652del n/a
7 TRCN0000488486 GACCTCCTCAAGAGGCAACGCTGC pLX_317 10.9% 73% 72.9% V5 (not translated due to prior stop codon) 947_947delCins73;1152_1652del n/a
8 TRCN0000489411 AAGTGGCATAGCCCCCTCAAGCTG pLX_317 20.6% 72.9% 72.8% V5 947_947delCins73;1152_1652del;2055_2056insG n/a
9 ccsbBroadEn_14566 pDONR223 100% 60% 33.7% None (many diffs) n/a
10 ccsbBroad304_14566 pLX_304 0% 60% 33.7% V5 (not translated due to prior stop codon) (many diffs) n/a
11 TRCN0000480621 AAGACTGTGGCACCAACTCCCGCC pLX_317 29.4% 60% 33.7% V5 (not translated due to prior stop codon) (many diffs) n/a
12 ccsbBroadEn_14562 pDONR223 100% 56.3% 30.3% None (many diffs) n/a
13 ccsbBroad304_14562 pLX_304 0% 56.3% 30.3% V5 (not translated due to prior stop codon) (many diffs) n/a
14 TRCN0000474396 TAATTGTTATTCACCCAAGAGACT pLX_317 23.8% 56.3% 30.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV