Transcript: Mouse NM_001310452.1

Mus musculus mitogen-activated protein kinase 8 (Mapk8), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Mapk8 (26419)
Length:
5626
CDS:
48..1202

Additional Resources:

NCBI RefSeq record:
NM_001310452.1
NBCI Gene record:
Mapk8 (26419)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310452.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304247 ATGTCCACAGATCCGACTTTG pLKO_005 1256 3UTR 100% 10.800 15.120 N Mapk8 n/a
2 TRCN0000304297 GATTTGGAGGAACGAACTAAG pLKO_005 1131 CDS 100% 10.800 8.640 N Mapk8 n/a
3 TRCN0000012584 CGGGACTTAAAGCCTAGTAAT pLKO.1 495 CDS 100% 13.200 9.240 N Mapk8 n/a
4 TRCN0000304296 GAGTGGAAAGAACTGATATAC pLKO_005 1098 CDS 100% 13.200 9.240 N Mapk8 n/a
5 TRCN0000055114 GCAGCTTATGATGCCATTCTT pLKO.1 171 CDS 100% 5.625 3.938 N Mapk8 n/a
6 TRCN0000010580 CCACAGAAATCCCTAGAAGAA pLKO.1 327 CDS 100% 4.950 3.465 N MAPK8 n/a
7 TRCN0000012585 CCATACATCAACGTCTGGTAT pLKO.1 1002 CDS 100% 4.950 3.465 N Mapk8 n/a
8 TRCN0000012587 CGCTGGATATAGCTTTGAGAA pLKO.1 845 CDS 100% 4.950 3.465 N Mapk8 n/a
9 TRCN0000012583 CGTCTGTCAATGACATGTCTT pLKO.1 1233 3UTR 100% 4.950 3.465 N Mapk8 n/a
10 TRCN0000196304 GATTGGAGATTCTACATTCAC pLKO.1 89 CDS 100% 4.950 3.465 N MAPK8 n/a
11 TRCN0000055115 GCAAATCTTTGCCAAGTGATT pLKO.1 384 CDS 100% 4.950 3.465 N Mapk8 n/a
12 TRCN0000055116 GCAAGAGATTTGTTATCCAAA pLKO.1 927 CDS 100% 4.950 3.465 N Mapk8 n/a
13 TRCN0000301243 GCAAGAGATTTGTTATCCAAA pLKO_005 927 CDS 100% 4.950 3.465 N Mapk8 n/a
14 TRCN0000012586 GCCTAGTAATATAGTAGTCAA pLKO.1 506 CDS 100% 4.950 3.465 N Mapk8 n/a
15 TRCN0000055113 GCTCTCAGCATCCATCGTCTT pLKO.1 1209 3UTR 100% 4.050 2.835 N Mapk8 n/a
16 TRCN0000055117 CCATTTCAGAATCAGACCCAT pLKO.1 225 CDS 100% 2.640 1.848 N Mapk8 n/a
17 TRCN0000310849 CTTCACTCTGCTGGAATTATT pLKO_005 471 CDS 100% 15.000 9.000 N Mapk8 n/a
18 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3586 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310452.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489471 GTGAGACGATACCTATTGCCACGT pLX_317 32.6% 91.6% 97.9% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000492156 AACAGCCTCTTGTTACGAGGTCTG pLX_317 19.2% 91.6% 97.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000489338 CTCATGACGTTAAATTTCAGTTAA pLX_317 28.4% 91.5% 97.6% V5 (many diffs) n/a
4 ccsbBroadEn_01287 pDONR223 100% 83.9% 88.7% None (many diffs) n/a
5 ccsbBroad304_01287 pLX_304 52.6% 83.9% 88.7% V5 (many diffs) n/a
Download CSV