Transcript: Human XM_011540103.2

PREDICTED: Homo sapiens bone morphogenetic protein receptor type 1A (BMPR1A), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BMPR1A (657)
Length:
6294
CDS:
446..2044

Additional Resources:

NCBI RefSeq record:
XM_011540103.2
NBCI Gene record:
BMPR1A (657)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540103.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194805 CCTGCTTAAATTGGCTTATTC pLKO.1 1435 CDS 100% 13.200 18.480 N BMPR1A n/a
2 TRCN0000021446 CGGCCTAATCATTTGGGAGAT pLKO.1 1744 CDS 100% 4.050 5.670 N LOC283155 n/a
3 TRCN0000000796 TCTCTCTATGACTTCCTGAAA pLKO.1 1391 CDS 100% 4.950 3.960 N BMPR1A n/a
4 TRCN0000196607 GCATAACTAATGGACATTGCT pLKO.1 672 CDS 100% 3.000 2.400 N BMPR1A n/a
5 TRCN0000000794 CGCCAATCTCATACAAGCCAT pLKO.1 2701 3UTR 100% 2.640 2.112 N BMPR1A n/a
6 TRCN0000194749 CTCACAGCATTGAGAATTAAG pLKO.1 1979 CDS 100% 13.200 9.240 N BMPR1A n/a
7 TRCN0000277917 CTCACAGCATTGAGAATTAAG pLKO_005 1979 CDS 100% 13.200 9.240 N BMPR1A n/a
8 TRCN0000021447 CGTGAGGTTGTGTGTGTCAAA pLKO.1 1856 CDS 100% 4.950 3.465 N LOC283155 n/a
9 TRCN0000000795 CGTGATTTGGAACAGGATGAA pLKO.1 1016 CDS 100% 4.950 3.465 N BMPR1A n/a
10 TRCN0000286056 CGTGATTTGGAACAGGATGAA pLKO_005 1016 CDS 100% 4.950 3.465 N BMPR1A n/a
11 TRCN0000196875 GCATAATTGCTATGATCATCT pLKO.1 933 CDS 100% 4.950 3.465 N BMPR1A n/a
12 TRCN0000021448 GCTGGTTTCGAGAAACAGAAA pLKO.1 1254 CDS 100% 4.950 3.465 N LOC283155 n/a
13 TRCN0000196462 GTTCATCATTTCTCGTGTTCA pLKO.1 490 CDS 100% 4.950 3.465 N BMPR1A n/a
14 TRCN0000277854 GTTCATCATTTCTCGTGTTCA pLKO_005 490 CDS 100% 4.950 3.465 N BMPR1A n/a
15 TRCN0000000797 GATGAATGTCTACGAGCAGTT pLKO.1 1913 CDS 100% 4.050 2.835 N BMPR1A n/a
16 TRCN0000277916 GATGAATGTCTACGAGCAGTT pLKO_005 1913 CDS 100% 4.050 2.835 N BMPR1A n/a
17 TRCN0000196733 GCTGTTAAATTCAACAGTGAC pLKO.1 1595 CDS 100% 0.405 0.284 N BMPR1A n/a
18 TRCN0000000798 GTCCAGATGATGCTATTAATA pLKO.1 645 CDS 100% 15.000 9.000 N BMPR1A n/a
19 TRCN0000277852 GTCCAGATGATGCTATTAATA pLKO_005 645 CDS 100% 15.000 9.000 N BMPR1A n/a
20 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 4584 3UTR 100% 4.950 2.475 Y GJD4 n/a
21 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 4584 3UTR 100% 4.950 2.475 Y C9orf85 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540103.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14549 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_14549 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465377 ACACAAAGACGATGAGACGCTTTT pLX_317 16.8% 99.9% 99.8% V5 1580C>T n/a
4 TRCN0000489757 CTCCGATCCCGCGCCATTGGAACA pLX_317 23.3% 100% 100% V5 (not translated due to prior stop codon) n/a
5 ccsbBroadEn_10423 pDONR223 100% 99.8% 99.6% None 9G>A;1585G>C;1590delA n/a
6 ccsbBroad304_10423 pLX_304 0% 99.8% 99.6% V5 (not translated due to frame shift) 9G>A;1585G>C;1590delA n/a
7 TRCN0000467651 GCTTTACATTAAATTTCAAATCGT pLX_317 25.5% 99.8% 99.6% V5 (not translated due to frame shift) 9G>A;1585G>C;1590delA n/a
Download CSV