Transcript: Human XR_001756516.1

PREDICTED: Homo sapiens leukocyte immunoglobulin like receptor A6 (LILRA6), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LILRA6 (79168)
Length:
2974
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001756516.1
NBCI Gene record:
LILRA6 (79168)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001756516.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414767 AGGGATCAATGTTGAGGTATT pLKO_005 1863 3UTR 100% 10.800 15.120 N LILRA6 n/a
2 TRCN0000422807 ACCTTACTTCCAATCTATGTT pLKO_005 1691 3UTR 100% 5.625 7.875 N LILRA6 n/a
3 TRCN0000434353 ATCATGTCTGATCACAAATTT pLKO_005 1661 3UTR 100% 15.000 10.500 N LILRA6 n/a
4 TRCN0000056784 GTGGAGGTTCACATGCTATTA pLKO.1 653 3UTR 100% 13.200 6.600 Y LILRB3 n/a
5 TRCN0000060502 GACACTTTCCTTCTGACCAAA pLKO.1 1134 3UTR 100% 4.950 2.475 Y LILRA6 n/a
6 TRCN0000056787 GCTCATAAGTACCAGGCTGAA pLKO.1 1200 3UTR 100% 4.050 2.025 Y LILRB3 n/a
7 TRCN0000060501 GACAGAAATAACCCACTGGAA pLKO.1 288 3UTR 100% 2.640 1.320 Y LILRA6 n/a
8 TRCN0000056786 CCTCCGATGTGGCTCACAGAA pLKO.1 503 3UTR 100% 1.650 0.825 Y LILRB3 n/a
9 TRCN0000056847 CGACAGATTTGTTCTGTATAA pLKO.1 833 3UTR 100% 1.320 0.660 Y LILRA2 n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2049 3UTR 100% 13.200 6.600 Y LIAS n/a
11 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2212 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001756516.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11582 pDONR223 100% 55.1% None (many diffs) n/a
2 ccsbBroad304_11582 pLX_304 0% 55.1% V5 (many diffs) n/a
3 TRCN0000476797 GACTTACTCCCCGGATCTCGTAGG pLX_317 13.1% 55.1% V5 (many diffs) n/a
4 ccsbBroadEn_11746 pDONR223 100% 36.6% None (many diffs) n/a
5 ccsbBroad304_11746 pLX_304 0% 36.6% V5 (many diffs) n/a
6 TRCN0000465237 AATGCATAAGCAGAACTCAGAGTC pLX_317 19.4% 36.6% V5 (many diffs) n/a
Download CSV