Transcript: Human XM_005259209.3

PREDICTED: Homo sapiens zinc finger protein 222 (ZNF222), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF222 (7673)
Length:
1572
CDS:
110..1492

Additional Resources:

NCBI RefSeq record:
XM_005259209.3
NBCI Gene record:
ZNF222 (7673)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005259209.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015592 AGGTCTCAAGATACCACCATA pLKO.1 380 CDS 100% 4.950 3.960 N ZNF222 n/a
2 TRCN0000015591 GCCAAAGAAAGCCATTGAAAT pLKO.1 1311 CDS 100% 13.200 9.240 N ZNF222 n/a
3 TRCN0000432448 TTCATTGATAGGCTAGATTTG pLKO_005 1016 CDS 100% 10.800 7.560 N ZNF222 n/a
4 TRCN0000015588 CCCAGATTAAAGCAAGACTAT pLKO.1 438 CDS 100% 4.950 3.465 N ZNF222 n/a
5 TRCN0000415936 GAGGCTTGTATGCCGGTCATA pLKO_005 1348 CDS 100% 4.950 3.465 N ZNF222 n/a
6 TRCN0000015590 GCACAATTTCCAGCTTCAGAA pLKO.1 853 CDS 100% 4.950 3.465 N ZNF222 n/a
7 TRCN0000015589 GCTTTAGACATGCTTCTAGTA pLKO.1 1266 CDS 100% 4.950 3.465 N ZNF222 n/a
8 TRCN0000424748 GAGTGAAATGCTATAAGTGTG pLKO_005 642 CDS 100% 4.050 2.430 N ZNF222 n/a
9 TRCN0000013097 CGCTTGAATCTGGATATAATT pLKO.1 1445 CDS 100% 15.000 7.500 Y ZNF230 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005259209.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01823 pDONR223 100% 82% 72.6% None (many diffs) n/a
2 ccsbBroad304_01823 pLX_304 0% 82% 72.6% V5 (many diffs) n/a
3 TRCN0000476788 CTGCGAAGACGGCAACATCAGATA pLX_317 29.8% 82% 72.6% V5 (many diffs) n/a
4 ccsbBroadEn_07176 pDONR223 100% 80.3% 71.6% None (many diffs) n/a
5 ccsbBroad304_07176 pLX_304 0% 80.3% 71.6% V5 (many diffs) n/a
6 TRCN0000481658 CTCCTGAACCAAGTGGAAAACCTC pLX_317 1.5% 80.3% 71.6% V5 (many diffs) n/a
7 ccsbBroadEn_07167 pDONR223 100% 72% 63.8% None (many diffs) n/a
8 ccsbBroad304_07167 pLX_304 0% 72% 63.8% V5 (many diffs) n/a
9 TRCN0000472100 CATTCGAGTACGACGCCCGCGCAT pLX_317 28.8% 72% 63.8% V5 (many diffs) n/a
Download CSV