Transcript: Mouse XM_017321385.1

PREDICTED: Mus musculus glyceraldehyde-3-phosphate dehydrogenase (Gapdh), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gapdh (14433)
Length:
1948
CDS:
442..1545

Additional Resources:

NCBI RefSeq record:
XM_017321385.1
NBCI Gene record:
Gapdh (14433)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321385.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041798 ACTGAGCAAGAGAGGCCCTAT pLKO.1 1669 3UTR 100% 4.050 2.430 N Gapdh n/a
2 TRCN0000041459 AGTGGCAAAGTGGAGATTGTT pLKO.1 508 CDS 100% 5.625 2.813 Y Gapdh n/a
3 TRCN0000041757 AGTGGAGATTGTTGCCATCAA pLKO.1 516 CDS 100% 4.950 2.475 Y Gm5138 n/a
4 TRCN0000041287 CAAATTCAACGGCACAGTCAA pLKO.1 597 CDS 100% 4.950 2.475 Y LOC382226 n/a
5 TRCN0000041232 CATGTTTGTGATGGGTGTGAA pLKO.1 822 CDS 100% 4.950 2.475 Y LOC382043 n/a
6 TRCN0000041231 CCAAGTATGATGACATCAAGA pLKO.1 1277 CDS 100% 4.950 2.475 Y LOC382043 n/a
7 TRCN0000036663 CCTCAACTACATGGTCTACAT pLKO.1 552 CDS 100% 4.950 2.475 Y LOC392549 n/a
8 TRCN0000041230 CGTGGAGTCTACTGGTGTCTT pLKO.1 720 CDS 100% 4.950 2.475 Y LOC382043 n/a
9 TRCN0000041460 CTGAGTATGTCGTGGAGTCTA pLKO.1 710 CDS 100% 4.950 2.475 Y Gapdh n/a
10 TRCN0000041327 GAAATATGACAACTCACTCAA pLKO.1 849 CDS 100% 4.950 2.475 Y LOC224923 n/a
11 TRCN0000041802 GAACCACGAGAAATATGACAA pLKO.1 840 CDS 100% 4.950 2.475 Y Gapdh n/a
12 TRCN0000041229 GACAACTTTGTCAAGCTCATT pLKO.1 1432 CDS 100% 4.950 2.475 Y LOC382043 n/a
13 TRCN0000041756 GTCAAGCTCATTTCCTGGTAT pLKO.1 1441 CDS 100% 4.950 2.475 Y Gm5138 n/a
14 TRCN0000041228 TCACTCAAGATTGTCAGCAAT pLKO.1 862 CDS 100% 4.950 2.475 Y LOC382043 n/a
15 TRCN0000041755 CATGGTCTACATGTTCCAGTA pLKO.1 561 CDS 100% 4.050 2.025 Y Gm5138 n/a
16 TRCN0000041754 TGACATCAAGAAGGTGGTGAA pLKO.1 1287 CDS 100% 4.050 2.025 Y Gm5138 n/a
17 TRCN0000041801 CAATGAATACGGCTACAGCAA pLKO.1 1574 3UTR 100% 2.640 1.320 Y Gapdh n/a
18 TRCN0000041285 CATCCATGACAACTTTGGCAT pLKO.1 924 CDS 100% 2.640 1.320 Y LOC382226 n/a
19 TRCN0000041462 CCCAGAACATCATCCCTGCAT pLKO.1 1043 CDS 100% 2.640 1.320 Y Gapdh n/a
20 TRCN0000041800 GACAACTTTGGCATTGTGGAA pLKO.1 931 CDS 100% 2.640 1.320 Y Gapdh n/a
21 TRCN0000041799 GAAGCTTGTCATCAACGGGAA pLKO.1 630 CDS 100% 2.160 1.080 Y Gapdh n/a
22 TRCN0000041461 GTATGACAATGAATACGGCTA pLKO.1 1568 3UTR 100% 2.160 1.080 Y Gapdh n/a
23 TRCN0000041286 CCAGGTTGTCTCCTGCGACTT pLKO.1 1356 CDS 100% 1.350 0.675 Y LOC382226 n/a
24 TRCN0000041753 CCCAGCAAGGACACTGAGCAA pLKO.1 1657 3UTR 100% 0.880 0.440 Y Gm5138 n/a
25 TRCN0000041284 GCCACCCAGAAGACTGTGGAT pLKO.1 982 CDS 100% 0.880 0.440 Y LOC382226 n/a
26 TRCN0000041326 CATTGCTCTCAATGACAACTT pLKO.1 1419 CDS 100% 0.495 0.248 Y LOC224923 n/a
27 TRCN0000041458 GCTGCCATTTGCAGTGGCAAA pLKO.1 496 CDS 100% 0.405 0.203 Y Gapdh n/a
28 TRCN0000041739 CATGACAACTTTGGCATTGTA pLKO.1 928 CDS 100% 5.625 2.813 Y Gm5069 n/a
29 TRCN0000041265 CCAGAACATCATCCCTGCATT pLKO.1 1044 CDS 100% 4.950 2.475 Y LOC224508 n/a
30 TRCN0000041323 GACATCAAGAAGGTGGTGAAA pLKO.1 1288 CDS 100% 4.950 2.475 Y LOC224923 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321385.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06254 pDONR223 100% 78.4% 77.8% None (many diffs) n/a
2 ccsbBroad304_06254 pLX_304 0% 78.4% 77.8% V5 (many diffs) n/a
3 TRCN0000474158 ACCTGGGTGCATCCAGAAGGTTGA pLX_317 21.9% 78.4% 77.8% V5 (many diffs) n/a
4 ccsbBroadEn_00615 pDONR223 100% 78.4% 77.8% None (many diffs) n/a
5 ccsbBroad304_00615 pLX_304 0% 78.4% 77.8% V5 (many diffs) n/a
6 TRCN0000465685 TTTTCCTTCCTAATCTATAGCCTT pLX_317 31.2% 78.4% 77.8% V5 (many diffs) n/a
Download CSV