Transcript: Human NM_001193533.2

Homo sapiens NIMA related kinase 4 (NEK4), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-09-29
Taxon:
Homo sapiens (human)
Gene:
NEK4 (6787)
Length:
5790
CDS:
204..2462

Additional Resources:

NCBI RefSeq record:
NM_001193533.2
NBCI Gene record:
NEK4 (6787)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001193533.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001698 CCACAATCAGTAGCGTAAATA pLKO.1 1015 CDS 100% 15.000 21.000 N NEK4 n/a
2 TRCN0000196265 GCGTAAATATTGACATCTTAC pLKO.1 1027 CDS 100% 10.800 15.120 N NEK4 n/a
3 TRCN0000194871 CCTTAAGGAGTAGTTGATAAA pLKO.1 2896 3UTR 100% 13.200 10.560 N NEK4 n/a
4 TRCN0000196710 GTCGTCATAATTCCTGCTATT pLKO.1 2867 3UTR 100% 10.800 8.640 N NEK4 n/a
5 TRCN0000194937 CATCAAAGGATCGACCATTAT pLKO.1 1756 CDS 100% 13.200 9.240 N NEK4 n/a
6 TRCN0000197013 GAAGGGAAAGGTCAGACAAAT pLKO.1 2025 CDS 100% 13.200 9.240 N NEK4 n/a
7 TRCN0000195511 CCCTGAAACTGGATTCTAAAG pLKO.1 2080 CDS 100% 10.800 7.560 N NEK4 n/a
8 TRCN0000196243 GCAGAACTGATAAGAACAATG pLKO.1 639 CDS 100% 10.800 7.560 N NEK4 n/a
9 TRCN0000001695 CCTACTACATGAGCCCTGAAT pLKO.1 445 CDS 100% 4.950 3.465 N NEK4 n/a
10 TRCN0000001697 GATTACTGTTTACTGAGCCTT pLKO.1 2707 3UTR 100% 2.640 1.848 N NEK4 n/a
11 TRCN0000082462 CCTCCCAAAGTGCCAGGATTA pLKO.1 3715 3UTR 100% 10.800 5.400 Y LOC388949 n/a
12 TRCN0000168774 GAGATGGAGTTTCACCATGTT pLKO.1 5220 3UTR 100% 4.950 2.475 Y LOC400464 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4116 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4116 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001193533.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489189 GAAACGACAAGCGCAACCCGACTA pLX_317 16.1% 89.3% 89.2% V5 (not translated due to prior stop codon) 89_90ins267;201A>G;406C>G n/a
2 ccsbBroadEn_14849 pDONR223 64.5% 77.1% 17.2% None (many diffs) n/a
3 ccsbBroad304_14849 pLX_304 0% 77.1% 17.2% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000471117 GTAGCGTTGCACTCCATGGACCCG pLX_317 19.8% 77.1% 17.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV