Transcript: Human NM_001348187.1

Homo sapiens DEAD-box helicase 27 (DDX27), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-02-25
Taxon:
Homo sapiens (human)
Gene:
DDX27 (55661)
Length:
2788
CDS:
62..2545

Additional Resources:

NCBI RefSeq record:
NM_001348187.1
NBCI Gene record:
DDX27 (55661)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348187.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414798 GCCTAATACCATCAAACATTA pLKO_005 1774 CDS 100% 13.200 18.480 N DDX27 n/a
2 TRCN0000415012 AGACGAGGAGGAAACTTTAAA pLKO_005 2495 CDS 100% 15.000 10.500 N DDX27 n/a
3 TRCN0000419767 GATGCTGAAGGAGATTGTAAA pLKO_005 1873 CDS 100% 13.200 9.240 N DDX27 n/a
4 TRCN0000433464 TGTCGTGGCCTGAAGAAATTC pLKO_005 2547 3UTR 100% 13.200 9.240 N DDX27 n/a
5 TRCN0000414278 GGATGCTGGATGAGTACTTTG pLKO_005 1278 CDS 100% 10.800 7.560 N DDX27 n/a
6 TRCN0000429703 GTCAGAAGCCCAGATCAATAC pLKO_005 2029 CDS 100% 10.800 7.560 N DDX27 n/a
7 TRCN0000446523 CATCCTGGCTGGTCTGTCTTT pLKO_005 2605 3UTR 100% 4.950 3.465 N DDX27 n/a
8 TRCN0000050006 CCTCAAATTCCGGGACAAGAT pLKO.1 1942 CDS 100% 4.950 3.465 N DDX27 n/a
9 TRCN0000050003 GCAGAGGAAAGGTCTCAGTTT pLKO.1 2240 CDS 100% 4.950 3.465 N DDX27 n/a
10 TRCN0000050004 GCAGGAATTTGACTTGGCCTT pLKO.1 2158 CDS 100% 2.160 1.512 N DDX27 n/a
11 TRCN0000050005 CCGATCCAGAAGGCGTGCATA pLKO.1 788 CDS 100% 1.650 0.990 N DDX27 n/a
12 TRCN0000050007 CCCTGAAACAGTATCGAGCTA pLKO.1 2430 CDS 100% 2.640 1.848 N DDX27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348187.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08562 pDONR223 100% 96.2% 96.1% None 1122_1214del;2204T>C n/a
2 ccsbBroad304_08562 pLX_304 0% 96.2% 96.1% V5 1122_1214del;2204T>C n/a
3 TRCN0000475485 CTGGCCTTTGCCATGGGTGGATAA pLX_317 15.3% 96.2% 96.1% V5 1122_1214del;2204T>C n/a
4 ccsbBroadEn_15907 pDONR223 0% 92.4% 92.3% None (many diffs) n/a
5 ccsbBroad304_15907 pLX_304 0% 92.4% 92.3% V5 (many diffs) n/a
6 TRCN0000474851 AGATCTTTTATGCAACTTCCCCCC pLX_317 16.3% 92.4% 92.3% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV