Transcript: Human NM_001350893.1

Homo sapiens thiamin pyrophosphokinase 1 (TPK1), transcript variant 13, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
TPK1 (27010)
Length:
2369
CDS:
352..765

Additional Resources:

NCBI RefSeq record:
NM_001350893.1
NBCI Gene record:
TPK1 (27010)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350893.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038006 GACTTTACTAAGTGCCTTAAA pLKO.1 331 5UTR 100% 13.200 10.560 N TPK1 n/a
2 TRCN0000197025 GCAGTCATAGGGCTGATAATA pLKO.1 1800 3UTR 100% 15.000 10.500 N TPK1 n/a
3 TRCN0000195020 CAAGAATCATTGACCTAATTG pLKO.1 1318 3UTR 100% 13.200 9.240 N TPK1 n/a
4 TRCN0000038004 CCTGCTTTCCACTGGGAATTT pLKO.1 133 5UTR 100% 13.200 9.240 N TPK1 n/a
5 TRCN0000219786 GTACTGCCTTGTAATTCTTAA pLKO.1 157 5UTR 100% 13.200 9.240 N TPK1 n/a
6 TRCN0000219787 GTGATTGGTGTGGCCTTATTC pLKO.1 572 CDS 100% 13.200 9.240 N TPK1 n/a
7 TRCN0000038007 CAGAGAATACTATGCTACTAA pLKO.1 270 5UTR 100% 5.625 3.938 N TPK1 n/a
8 TRCN0000195506 CAAGAGGAATCGCTGATCTAC pLKO.1 502 CDS 100% 4.950 3.465 N TPK1 n/a
9 TRCN0000038008 CATTGGTCAGTACTTCCAATA pLKO.1 671 CDS 100% 1.080 0.756 N TPK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350893.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491741 TACGCAACGCCATGAATTACAAAA pLX_317 83.7% 99.2% 99.2% V5 (not translated due to prior stop codon) 411_412insTTG n/a
2 ccsbBroadEn_14113 pDONR223 100% 99% 4.3% None 14_16delAGAinsG;25A>G n/a
3 ccsbBroad304_14113 pLX_304 0% 99% 4.3% V5 (not translated due to prior stop codon) 14_16delAGAinsG;25A>G n/a
4 TRCN0000471369 ATATTAAGTTAGTCCCACAAACCT pLX_317 100% 99% 4.3% V5 (not translated due to prior stop codon) 14_16delAGAinsG;25A>G n/a
5 TRCN0000489639 ATTGATGTCTGGGAAGTCTCCCAC pLX_317 56.9% 56.3% 56.3% V5 (not translated due to prior stop codon) 0_1ins318 n/a
6 ccsbBroadEn_11838 pDONR223 100% 56.1% 55.9% None 0_1ins318;260_261delTGinsGT n/a
7 ccsbBroad304_11838 pLX_304 0% 56.1% 55.9% V5 0_1ins318;260_261delTGinsGT n/a
8 TRCN0000470689 CAACATTATCCATTCCACCATCGT pLX_317 56.2% 56.1% 55.9% V5 0_1ins318;260_261delTGinsGT n/a
9 ccsbBroadEn_15039 pDONR223 0% 56.1% 55.9% None 0_1ins318;260_261delTGinsGT n/a
10 ccsbBroad304_15039 pLX_304 0% 56.1% 55.9% V5 0_1ins318;260_261delTGinsGT n/a
11 TRCN0000480139 CATTGGTCGATGTTTAGTACGTCG pLX_317 57% 56.1% 55.9% V5 0_1ins318;260_261delTGinsGT n/a
Download CSV