Transcript: Human XM_017012324.2

PREDICTED: Homo sapiens phosphorylase kinase catalytic subunit gamma 1 (PHKG1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHKG1 (5260)
Length:
2598
CDS:
173..1471

Additional Resources:

NCBI RefSeq record:
XM_017012324.2
NBCI Gene record:
PHKG1 (5260)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012324.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006205 GCCTACGCTTTCCGAATCTAT pLKO.1 1352 CDS 100% 5.625 7.875 N PHKG1 n/a
2 TRCN0000197280 GATGATCATGAGCGGCAACTA pLKO.1 1027 CDS 100% 4.950 6.930 N PHKG1 n/a
3 TRCN0000219704 TGCGGATCTACTACCAGTACC pLKO.1 1254 CDS 100% 4.050 5.670 N PHKG1 n/a
4 TRCN0000199306 CCTGAGATTATCGAGTGCTCC pLKO.1 884 CDS 100% 2.160 3.024 N PHKG1 n/a
5 TRCN0000382232 AGGACTTCTATGAGAATTATG pLKO_005 213 CDS 100% 13.200 9.240 N PHKG1 n/a
6 TRCN0000379650 ATACAGCTGAAGGACACTTAT pLKO_005 434 CDS 100% 13.200 9.240 N PHKG1 n/a
7 TRCN0000219702 ACTTATGAGACCAACACTTTC pLKO.1 449 CDS 100% 10.800 7.560 N PHKG1 n/a
8 TRCN0000219703 TGATCTGCACCTTGCACAAAC pLKO.1 582 CDS 100% 10.800 7.560 N PHKG1 n/a
9 TRCN0000380988 TTATCGAGTGCTCCATGAATG pLKO_005 891 CDS 100% 10.800 7.560 N PHKG1 n/a
10 TRCN0000006202 GCACAGGACTTCTATGAGAAT pLKO.1 209 CDS 100% 4.950 3.465 N PHKG1 n/a
11 TRCN0000006201 GCCACCATCTCCATTTCTCTT pLKO.1 1756 3UTR 100% 4.950 3.465 N PHKG1 n/a
12 TRCN0000006203 GCTGATGCTGAGGATGATCAT pLKO.1 1015 CDS 100% 4.950 3.465 N PHKG1 n/a
13 TRCN0000006204 CTATGAGAATTATGAGCCCAA pLKO.1 220 CDS 100% 2.160 1.512 N PHKG1 n/a
14 TRCN0000199952 GCCGTGAAGGTCATCGACGTC pLKO.1 311 CDS 100% 0.000 0.000 N PHKG1 n/a
15 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1981 3UTR 100% 4.950 2.475 Y CFLAR n/a
16 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1981 3UTR 100% 4.950 2.475 Y C19orf31 n/a
17 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 722 CDS 100% 4.950 2.475 Y n/a
18 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1979 3UTR 100% 4.950 2.475 Y ERN2 n/a
19 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1979 3UTR 100% 4.950 2.475 Y P3H4 n/a
20 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1979 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012324.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489075 CTGCCCGAGCCCAGCAATAAATTT pLX_317 32.1% 89.5% 89.5% V5 (not translated due to prior stop codon) 546_680del n/a
2 TRCN0000491471 AAACGAACCACGTCGCTTGAGTTC pLX_317 19.4% 89.5% 89.3% V5 546_680del;1296_1297insG n/a
3 TRCN0000473797 ACCTCCCCATTAAGACGTTATGAT pLX_317 36.8% 89.3% 31.2% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_14755 pDONR223 100% 89.2% 31.2% None (many diffs) n/a
5 ccsbBroad304_14755 pLX_304 0% 89.2% 31.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV