Transcript: Human XM_005252004.2

PREDICTED: Homo sapiens neurotrophic receptor tyrosine kinase 2 (NTRK2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NTRK2 (4915)
Length:
8775
CDS:
629..3145

Additional Resources:

NCBI RefSeq record:
XM_005252004.2
NBCI Gene record:
NTRK2 (4915)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005252004.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273160 CCTTAAGGATAACTAACATTT pLKO_005 1374 CDS 100% 13.200 18.480 N NTRK2 n/a
2 TRCN0000197207 GCGCTTCAGTGGTTCTATAAC pLKO.1 1568 CDS 100% 13.200 18.480 N NTRK2 n/a
3 TRCN0000284928 ATCGTGGCATTTCCGAGATTG pLKO_005 782 CDS 100% 10.800 15.120 N NTRK2 n/a
4 TRCN0000195114 CCTAATATGTATTGGGATGTT pLKO.1 1304 CDS 100% 4.950 6.930 N NTRK2 n/a
5 TRCN0000002245 GCACATCAAGCGACATAACAT pLKO.1 2269 CDS 100% 5.625 4.500 N NTRK2 n/a
6 TRCN0000273162 GCACATCAAGCGACATAACAT pLKO_005 2269 CDS 100% 5.625 4.500 N NTRK2 n/a
7 TRCN0000002243 CCAACTATCACATTTCTCGAA pLKO.1 1487 CDS 100% 2.640 2.112 N NTRK2 n/a
8 TRCN0000196522 GCTATTTGAATGGTCAGATAT pLKO.1 4878 3UTR 100% 13.200 9.240 N NTRK2 n/a
9 TRCN0000273090 GCTATTTGAATGGTCAGATAT pLKO_005 4878 3UTR 100% 13.200 9.240 N NTRK2 n/a
10 TRCN0000273089 TCCTGGTGGGCAATCCATTTA pLKO_005 1059 CDS 100% 13.200 9.240 N NTRK2 n/a
11 TRCN0000196299 GACTGAGAAATCTGACAATTG pLKO.1 903 CDS 100% 10.800 7.560 N NTRK2 n/a
12 TRCN0000002242 CCACTCCATCACATCTCCAAT pLKO.1 2114 CDS 100% 4.950 3.465 N NTRK2 n/a
13 TRCN0000195539 CCAGATTGAAAGGGAGTGATT pLKO.1 4990 3UTR 100% 4.950 3.465 N NTRK2 n/a
14 TRCN0000002246 CCTTGTTGTATTCCTGCCTTT pLKO.1 3567 3UTR 100% 4.050 2.835 N NTRK2 n/a
15 TRCN0000002244 GAGGAAGAACATCAAGGGCAT pLKO.1 3064 CDS 100% 2.160 1.512 N NTRK2 n/a
16 TRCN0000023416 GAGAGCATCATGTACAGGAAA pLKO.1 2843 CDS 100% 4.950 2.970 N LOC382761 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005252004.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14721 pDONR223 0% 98% 98% None 1396_1443del n/a
2 ccsbBroad304_14721 pLX_304 0% 98% 98% V5 1396_1443del n/a
3 TRCN0000480309 ACAATAAGTGTCCCAGTTAAGTTT pLX_317 14.3% 98% 98% V5 1396_1443del n/a
4 TRCN0000488063 CTCACTGTCGAGCAACCATACTGA pLX_317 13% 98% 98% V5 1396_1443del n/a
5 TRCN0000488161 TATCAGACTTTGGGGGGGCAAAAC pLX_317 12.7% 98% 98% V5 (not translated due to prior stop codon) 1396_1443del n/a
6 ccsbBroadEn_01113 pDONR223 100% 56.6% 55.4% None (many diffs) n/a
7 ccsbBroad304_01113 pLX_304 0% 56.6% 55.4% V5 (many diffs) n/a
8 TRCN0000489350 CGCGGCAGTCTCCAGTCATTGATT pLX_317 37.3% 41.5% .8% V5 (not translated due to prior stop codon) 1_1465del;2510_2514delTAGGC n/a
Download CSV