Transcript: Human XM_005264716.3

PREDICTED: Homo sapiens EPH receptor A3 (EPHA3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EPHA3 (2042)
Length:
3124
CDS:
126..2882

Additional Resources:

NCBI RefSeq record:
XM_005264716.3
NBCI Gene record:
EPHA3 (2042)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005264716.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196767 GCAATAGCATTCCATTGGTTT pLKO.1 442 CDS 100% 4.950 6.930 N EPHA3 n/a
2 TRCN0000194718 CCTGACACTATATACGTATTC pLKO.1 1626 CDS 100% 10.800 7.560 N EPHA3 n/a
3 TRCN0000280072 CCTGACACTATATACGTATTC pLKO_005 1626 CDS 100% 10.800 7.560 N EPHA3 n/a
4 TRCN0000196830 GATGAAAGTTTCACTCAAATG pLKO.1 570 CDS 100% 10.800 7.560 N EPHA3 n/a
5 TRCN0000280006 GATGAAAGTTTCACTCAAATG pLKO_005 570 CDS 100% 10.800 7.560 N EPHA3 n/a
6 TRCN0000006410 CCTTCCAATGAAGTCAATCTA pLKO.1 201 CDS 100% 5.625 3.938 N EPHA3 n/a
7 TRCN0000280073 CCTTCCAATGAAGTCAATCTA pLKO_005 201 CDS 100% 5.625 3.938 N EPHA3 n/a
8 TRCN0000196546 GCCACCAACATATCCATTGAT pLKO.1 1977 CDS 100% 5.625 3.938 N EPHA3 n/a
9 TRCN0000006409 GCCGCAAGTTTGAGTTTGAAA pLKO.1 1687 CDS 100% 5.625 3.938 N EPHA3 n/a
10 TRCN0000280005 GCCGCAAGTTTGAGTTTGAAA pLKO_005 1687 CDS 100% 5.625 3.938 N EPHA3 n/a
11 TRCN0000006412 CCTTTGAGATTGATGCCGTTA pLKO.1 1342 CDS 100% 4.050 2.835 N EPHA3 n/a
12 TRCN0000006411 CCCAATATCATTCGACTGGAA pLKO.1 2163 CDS 100% 2.640 1.848 N EPHA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005264716.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000469001 ACGCCCGCCAGGCTCCTGATCCAC pLX_317 15.1% 93.4% 93.1% V5 2748_2749insG;2754_2754delAins193 n/a
2 ccsbBroadEn_14626 pDONR223 0% 93.3% 93.1% None 2748_2749insG;2754_2754delAins195 n/a
3 ccsbBroad304_14626 pLX_304 0% 93.3% 93.1% V5 2748_2749insG;2754_2754delAins195 n/a
4 TRCN0000488160 AGCACATACATTTTTCCTTCAGTA pLX_317 7.6% 93.3% 93.1% V5 (not translated due to prior stop codon) 2748_2749insG;2754_2754delAins195 n/a
5 ccsbBroadEn_06168 pDONR223 100% 93.2% 92.9% None (many diffs) n/a
6 ccsbBroad304_06168 pLX_304 0% 93.2% 92.9% V5 (many diffs) n/a
7 TRCN0000477417 CTGCCGATGCAGGTGTCCGCCCGG pLX_317 15.8% 93.2% 92.9% V5 (many diffs) n/a
8 TRCN0000489236 TTTGTTTACGTCTACAACCGATTA pLX_317 27.4% 33.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV