Transcript: Mouse XM_006526606.2

PREDICTED: Mus musculus actin, alpha 2, smooth muscle, aorta (Acta2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Acta2 (11475)
Length:
1177
CDS:
320..1162

Additional Resources:

NCBI RefSeq record:
XM_006526606.2
NBCI Gene record:
Acta2 (11475)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526606.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091665 CTGACGCTGAAGTATCCGATA pLKO.1 518 CDS 100% 4.050 5.670 N Acta2 n/a
2 TRCN0000091666 CACTCTTTCTATAACGAGCTT pLKO.1 587 CDS 100% 2.640 3.696 N Acta2 n/a
3 TRCN0000429088 GTGACTCACAACGTGCCTATC pLKO_005 800 CDS 100% 6.000 4.800 N Acta2 n/a
4 TRCN0000091667 TCAGGGAGTAATGGTTGGAAT pLKO.1 445 CDS 100% 4.950 3.465 N Acta2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526606.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00014 pDONR223 100% 67.1% 72.6% None (many diffs) n/a
2 ccsbBroad304_00014 pLX_304 0% 67.1% 72.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000467679 GCTACTGCTTTGAGGGTTATAACT pLX_317 37.9% 67.1% 72.6% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_00015 pDONR223 100% 62.9% 71% None (many diffs) n/a
5 ccsbBroad304_00015 pLX_304 0% 62.9% 71% V5 (many diffs) n/a
6 TRCN0000468012 TCTATATTCTTCCCTCACTCATAA pLX_317 37.9% 62.9% 71% V5 (many diffs) n/a
7 ccsbBroadEn_05763 pDONR223 100% 60% 67.1% None (many diffs) n/a
8 ccsbBroad304_05763 pLX_304 53.1% 60% 67.1% V5 (many diffs) n/a
9 TRCN0000470279 TCAAGCCTGGAACGGGCTCACGTC pLX_317 31.7% 60% 67.1% V5 (many diffs) n/a
10 ccsbBroadEn_13808 pDONR223 100% 59.5% 67.6% None (many diffs) n/a
11 ccsbBroad304_13808 pLX_304 0% 59.5% 67.6% V5 (not translated due to frame shift) (many diffs) n/a
12 TRCN0000471742 AATGGGAGTTCTCACGTCAGGTCC pLX_317 44.8% 59.5% 67.6% V5 (not translated due to frame shift) (many diffs) n/a
13 ccsbBroadEn_15351 pDONR223 0% 59.5% 67.6% None (many diffs) n/a
14 ccsbBroad304_15351 pLX_304 0% 59.5% 67.6% V5 (many diffs) n/a
15 ccsbBroadEn_05764 pDONR223 100% 59.5% 67.6% None (many diffs) n/a
16 ccsbBroad304_05764 pLX_304 0% 59.5% 67.6% V5 (many diffs) n/a
17 TRCN0000466781 AATTGTGGTGCTTGTTGCCGCCTG pLX_317 31.7% 59.5% 67.6% V5 (many diffs) n/a
Download CSV