Transcript: Human XM_006720125.3

PREDICTED: Homo sapiens heterogeneous nuclear ribonucleoprotein C (HNRNPC), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HNRNPC (3183)
Length:
2485
CDS:
901..1782

Additional Resources:

NCBI RefSeq record:
XM_006720125.3
NBCI Gene record:
HNRNPC (3183)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006720125.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006644 GCGCTTGTCTAAGATCAAATT pLKO.1 1830 3UTR 100% 13.200 18.480 N HNRNPC n/a
2 TRCN0000320716 GCGCTTGTCTAAGATCAAATT pLKO_005 1830 3UTR 100% 13.200 18.480 N HNRNPC n/a
3 TRCN0000006645 GCCTTCGTTCAGTATGTTAAT pLKO.1 1057 CDS 100% 13.200 9.240 N HNRNPC n/a
4 TRCN0000320782 GCCTTCGTTCAGTATGTTAAT pLKO_005 1057 CDS 100% 13.200 9.240 N HNRNPC n/a
5 TRCN0000320708 TCAACGGGACTATTATGATAG pLKO_005 1245 CDS 100% 10.800 6.480 N HNRNPC n/a
6 TRCN0000006647 CTTGTGGTCAAGAAATCTGAT pLKO.1 976 CDS 100% 4.950 2.970 N HNRNPC n/a
7 TRCN0000239537 GATGACCTTCAGGCCATTAAG pLKO_005 1432 CDS 100% 13.200 6.600 Y HNRNPCL2 n/a
8 TRCN0000006646 CTGGATGATGATGATAATGAA pLKO.1 1660 CDS 100% 5.625 2.813 Y HNRNPC n/a
9 TRCN0000320707 CTGGATGATGATGATAATGAA pLKO_005 1660 CDS 100% 5.625 2.813 Y HNRNPC n/a
10 TRCN0000112057 CAGTAGAGATGAAGAATGAAA pLKO.1 1535 CDS 100% 5.625 3.938 N Hnrnpc n/a
11 TRCN0000075086 GCTTCAATTCTAAGAGTGGAA pLKO.1 1376 CDS 100% 2.640 1.320 Y HNRNPCL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006720125.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15449 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_15449 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469153 TTAATGTCGATCTGAGGGCATCCG pLX_317 42.7% 100% 100% V5 n/a
4 ccsbBroadEn_13871 pDONR223 100% 99.7% 36.5% None 315_316insG;876C>A n/a
5 ccsbBroad304_13871 pLX_304 0% 99.7% 36.5% V5 (not translated due to prior stop codon) 315_316insG;876C>A n/a
6 ccsbBroadEn_15450 pDONR223 0% 99.7% 99.3% None 632A>G;692A>G n/a
7 ccsbBroad304_15450 pLX_304 0% 99.7% 99.3% V5 632A>G;692A>G n/a
8 TRCN0000470594 TAAACACACACACGGATGCCGTTA pLX_317 42.9% 99.7% 99.3% V5 632A>G;692A>G n/a
9 ccsbBroadEn_06387 pDONR223 100% 95.7% 95.7% None 316_317ins39 n/a
10 ccsbBroad304_06387 pLX_304 0% 95.7% 95.7% V5 316_317ins39 n/a
11 TRCN0000473030 TTGCTACGTAGGGTTTTTCAAGGC pLX_317 52.1% 95.7% 95.7% V5 316_317ins39 n/a
12 ccsbBroadEn_10043 pDONR223 100% 94.6% 90.7% None (many diffs) n/a
13 ccsbBroad304_10043 pLX_304 0% 94.6% 90.7% V5 (many diffs) n/a
14 TRCN0000478014 ATTTTTTGTTACGCAATAGTATCC pLX_317 6.2% 94.6% 90.7% V5 (many diffs) n/a
15 ccsbBroadEn_10165 pDONR223 100% 93.5% 88.3% None (many diffs) n/a
16 ccsbBroad304_10165 pLX_304 0% 93.5% 88.3% V5 (many diffs) n/a
17 TRCN0000477352 GAGCCTAGTGTCAGGTTCCGGTGG pLX_317 39% 93.5% 88.3% V5 (many diffs) n/a
Download CSV