Transcript: Human XM_006724754.2

PREDICTED: Homo sapiens X-linked inhibitor of apoptosis (XIAP), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
XIAP (331)
Length:
8524
CDS:
240..1733

Additional Resources:

NCBI RefSeq record:
XM_006724754.2
NBCI Gene record:
XIAP (331)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006724754.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231579 ACACGTACTTGTGCGAATTAT pLKO_005 2260 3UTR 100% 15.000 21.000 N XIAP n/a
2 TRCN0000003785 AGCTGTAGATAGATGGCAATA pLKO.1 443 CDS 100% 10.800 15.120 N XIAP n/a
3 TRCN0000010817 GTGCGGTGCTTTAGTTGTCAT pLKO.1 420 CDS 100% 4.950 6.930 N XIAP n/a
4 TRCN0000231578 AGATATCTGGGAGCAACTATA pLKO_005 1432 CDS 100% 13.200 9.240 N XIAP n/a
5 TRCN0000231577 ATCCATCCATGGCAGATTATG pLKO_005 1015 CDS 100% 13.200 9.240 N XIAP n/a
6 TRCN0000003787 GACATGGATATACTCAGTTAA pLKO.1 1058 CDS 100% 13.200 9.240 N XIAP n/a
7 TRCN0000231576 GACTCTACTACACAGGTATTG pLKO_005 802 CDS 100% 10.800 7.560 N XIAP n/a
8 TRCN0000231575 GAGATACCGTGCGGTGCTTTA pLKO_005 412 CDS 100% 10.800 7.560 N XIAP n/a
9 TRCN0000003788 CAGAATGGTCAGTACAAAGTT pLKO.1 570 CDS 100% 5.625 3.938 N XIAP n/a
10 TRCN0000003786 GCACTCCAACTTCTAATCAAA pLKO.1 4372 3UTR 100% 5.625 3.938 N XIAP n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 5159 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 7392 3UTR 100% 4.950 2.475 Y n/a
13 TRCN0000165704 CAATGGCACAATCTTGGCTCA pLKO.1 7291 3UTR 100% 2.160 1.080 Y LOC652276 n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5160 3UTR 100% 13.200 6.600 Y LIAS n/a
15 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 7925 3UTR 100% 10.800 5.400 Y SMIM11A n/a
16 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3840 3UTR 100% 5.625 2.813 Y KLHL30 n/a
17 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3840 3UTR 100% 5.625 2.813 Y EID2B n/a
18 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 5933 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006724754.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05835 pDONR223 100% 99.9% 99.7% None 1485T>G n/a
2 ccsbBroad304_05835 pLX_304 45.4% 99.9% 99.7% V5 1485T>G n/a
3 TRCN0000469235 GTCGCCACATCGCTAGCGTAGGTT pLX_317 25.4% 99.9% 99.7% V5 1485T>G n/a
4 ccsbBroadEn_09370 pDONR223 100% 59.2% 55.1% None (many diffs) n/a
5 ccsbBroad304_09370 pLX_304 0% 59.2% 55.1% V5 (many diffs) n/a
6 TRCN0000474853 AGCACGGCACACCGTCACAGTTAT pLX_317 49.7% 59.2% 55.1% V5 (many diffs) n/a
7 ccsbBroadEn_09369 pDONR223 100% 41.2% 37.8% None (many diffs) n/a
8 ccsbBroad304_09369 pLX_304 0% 41.2% 37.8% V5 (many diffs) n/a
9 TRCN0000469926 GTCTCATAATGATACAGGACTTGT pLX_317 54.1% 41.2% 37.8% V5 (many diffs) n/a
Download CSV