Transcript: Mouse XM_011241139.2

PREDICTED: Mus musculus Braf transforming gene (Braf), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Braf (109880)
Length:
9875
CDS:
127..2724

Additional Resources:

NCBI RefSeq record:
XM_011241139.2
NBCI Gene record:
Braf (109880)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241139.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022593 CCAGCTACCTTATTCAAACAT pLKO.1 2376 CDS 100% 5.625 7.875 N Braf n/a
2 TRCN0000307373 CCAGCTACCTTATTCAAACAT pLKO_005 2376 CDS 100% 5.625 7.875 N Braf n/a
3 TRCN0000054347 CCGTTGTCAAACATGTGGTTA pLKO.1 1194 CDS 100% 4.950 6.930 N Braf n/a
4 TRCN0000287177 CCGTTGTCAAACATGTGGTTA pLKO_005 1194 CDS 100% 4.950 6.930 N Braf n/a
5 TRCN0000054345 CCACATCATTGAGACCAAATT pLKO.1 2043 CDS 100% 13.200 9.240 N Braf n/a
6 TRCN0000287179 CCACATCATTGAGACCAAATT pLKO_005 2043 CDS 100% 13.200 9.240 N Braf n/a
7 TRCN0000195609 CTCAGTAAGGTACGGAGTAAC pLKO.1 2452 CDS 100% 10.800 7.560 N BRAF n/a
8 TRCN0000196918 GAACATATAGAGGCCCTATTG pLKO.1 583 CDS 100% 10.800 7.560 N BRAF n/a
9 TRCN0000022592 CACCACAGAAACCTATCGTTA pLKO.1 860 CDS 100% 4.950 3.465 N Braf n/a
10 TRCN0000294553 CACCACAGAAACCTATCGTTA pLKO_005 860 CDS 100% 4.950 3.465 N Braf n/a
11 TRCN0000022590 CCCACTTACAACACACAACTT pLKO.1 1107 CDS 100% 4.950 3.465 N Braf n/a
12 TRCN0000054343 GCTACCTTATTCAAACATCAA pLKO.1 2379 CDS 100% 4.950 3.465 N Braf n/a
13 TRCN0000054346 CGAGGATACCTATCTCCAGAT pLKO.1 2431 CDS 100% 4.050 2.835 N Braf n/a
14 TRCN0000287119 CGAGGATACCTATCTCCAGAT pLKO_005 2431 CDS 100% 4.050 2.835 N Braf n/a
15 TRCN0000054344 GCAGATGAAGATCATCGCAAT pLKO.1 1459 CDS 100% 4.050 2.835 N Braf n/a
16 TRCN0000302346 GCAGATGAAGATCATCGCAAT pLKO_005 1459 CDS 100% 4.050 2.835 N Braf n/a
17 TRCN0000022589 CCTGGGTAATGGAGCAGATTT pLKO.1 714 CDS 100% 13.200 7.920 N Braf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241139.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00174 pDONR223 100% 81.8% 85.9% None (many diffs) n/a
2 ccsbBroad304_00174 pLX_304 0% 81.8% 85.9% V5 (many diffs) n/a
3 TRCN0000478042 TCTGAATTAGGGTTGATCCCCCGC pLX_317 17.9% 81.8% 85.9% V5 (many diffs) n/a
4 TRCN0000489575 CGTTCGGAATTCTGTGTTGTACCC pLX_317 15.7% 81.8% 85.9% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489494 GTTAACTACCATGGAAACCTGCTA pLX_317 14.9% 81.8% 85.9% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_16175 pDONR223 0% 81.8% 85.8% None (many diffs) n/a
7 ccsbBroad304_16175 pLX_304 0% 81.8% 85.8% V5 (many diffs) n/a
8 TRCN0000491583 CCCTCTGATACCGCCGCCACCAGA pLX_317 17.6% 81.8% 85.8% V5 (not translated due to prior stop codon) (many diffs) n/a
9 ccsbBroadEn_14553 pDONR223 65.1% 76.4% 22.6% None (many diffs) n/a
10 ccsbBroad304_14553 pLX_304 0% 76.4% 22.6% V5 (not translated due to prior stop codon) (many diffs) n/a
11 TRCN0000480310 GCCCGGTAACTCGCTTTGGCCAAA pLX_317 17.4% 76.4% 22.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV