Transcript: Human XM_011535068.2

PREDICTED: Homo sapiens NIMA related kinase 5 (NEK5), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NEK5 (341676)
Length:
1691
CDS:
20..1471

Additional Resources:

NCBI RefSeq record:
XM_011535068.2
NBCI Gene record:
NEK5 (341676)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148037 TGGAGCTCACGAGAAAACCC pXPR_003 CGG 897 62% 10 1.1747 NEK5 NEK5 76120
2 BRDN0001146851 TCTTAGCAAGAACGGAATGG pXPR_003 TGG 637 44% 7 0.7047 NEK5 NEK5 76117
3 BRDN0001148329 AAAAGGATCAATAGACAACG pXPR_003 GGG 500 34% 5 0.5071 NEK5 NEK5 76119
4 BRDN0001144996 ACAATATTACCATTGACTTG pXPR_003 GGG 1417 98% 13 -0.5815 NEK5 NEK5 76118
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535068.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358267 ACAGATTTCTCTAGGACTAAA pLKO_005 565 CDS 100% 13.200 9.240 N NEK5 n/a
2 TRCN0000358266 CCTTCGGGAAAGCATACTTAG pLKO_005 276 CDS 100% 10.800 7.560 N NEK5 n/a
3 TRCN0000021411 GCCCACCAAGATCAAGGATAT pLKO.1 1164 CDS 100% 10.800 7.560 N NEK5 n/a
4 TRCN0000021410 GCCTTCTTCAATTCATTTCAA pLKO.1 428 CDS 100% 5.625 3.375 N NEK5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535068.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15307 pDONR223 79.8% 53.8% 52.7% None (many diffs) n/a
2 ccsbBroad304_15307 pLX_304 0% 53.8% 52.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000473796 AACCCCACCAACCTATGGAACTGT pLX_317 20.5% 53.8% 52.7% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_10033 pDONR223 100% 52.3% 51.7% None (many diffs) n/a
5 ccsbBroad304_10033 pLX_304 0% 52.3% 51.7% V5 (many diffs) n/a
6 TRCN0000479295 TGCCTTTTGATCCACTCGCCGGAC pLX_317 16.5% 52.3% 51.7% V5 (many diffs) n/a
Download CSV