Transcript: Human XM_011536785.2

PREDICTED: Homo sapiens MIA SH3 domain ER export factor 2 (MIA2), transcript variant X19, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MIA2 (4253)
Length:
2756
CDS:
198..2372

Additional Resources:

NCBI RefSeq record:
XM_011536785.2
NBCI Gene record:
MIA2 (4253)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536785.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165720 CCTCAGGTTTGATTCCACCTT pLKO.1 2305 CDS 100% 2.640 1.848 N MIA2 n/a
2 TRCN0000161286 GCTCTAATGCTTTCTGGACTA pLKO.1 192 5UTR 100% 4.050 2.430 N MIA2 n/a
3 TRCN0000162381 CAAGGGCAGATTATTTCCCAT pLKO.1 1305 CDS 100% 2.640 1.584 N MIA2 n/a
4 TRCN0000337222 AGAGCTTACAGAGCATATTAA pLKO_005 1001 CDS 100% 15.000 7.500 Y CTAGE9 n/a
5 TRCN0000337161 ATGAATTGATGGCGGATATTT pLKO_005 445 CDS 100% 15.000 7.500 Y CTAGE9 n/a
6 TRCN0000159554 CCAAAGATGATCTTGGTAATT pLKO.1 1954 CDS 100% 13.200 6.600 Y MIA2 n/a
7 TRCN0000161026 GAAGAGCTTACAGAGCATATT pLKO.1 999 CDS 100% 13.200 6.600 Y CTAGE4 n/a
8 TRCN0000147704 GATGAATTGATGGCGGATATT pLKO.1 444 CDS 100% 13.200 6.600 Y CTAGE6 n/a
9 TRCN0000160201 CCAAAGATCTTGAAGAAGAAT pLKO.1 1261 CDS 100% 5.625 2.813 Y CTAGE4 n/a
10 TRCN0000160970 GACCATCAGATTACCAATGAA pLKO.1 1656 CDS 100% 5.625 2.813 Y CTAGE4 n/a
11 TRCN0000005400 GCTGAAAGAAACCTCAATGAT pLKO.1 1365 CDS 100% 5.625 2.813 Y CTAGE1 n/a
12 TRCN0000158680 GCTTTGAAGAAACTGATTCAT pLKO.1 891 CDS 100% 5.625 2.813 Y MIA2 n/a
13 TRCN0000146679 CAATGCCTTCAGAAATGGAAT pLKO.1 1918 CDS 100% 4.950 2.475 Y CTAGE6 n/a
14 TRCN0000158611 CAGATTATTTCCCATGAGAAA pLKO.1 1311 CDS 100% 4.950 2.475 Y MIA2 n/a
15 TRCN0000166046 CCACAGCAAGAAACCTGACAA pLKO.1 2355 CDS 100% 4.950 2.475 Y CTAGE4 n/a
16 TRCN0000005399 CGGATGATGATAACTTGGAAT pLKO.1 814 CDS 100% 4.950 2.475 Y CTAGE1 n/a
17 TRCN0000158647 CGGATGATGATAACTTGGAAT pLKO.1 814 CDS 100% 4.950 2.475 Y MIA2 n/a
18 TRCN0000158825 GCAGATTATTTCCCATGAGAA pLKO.1 1310 CDS 100% 4.950 2.475 Y MIA2 n/a
19 TRCN0000161860 GCCAAAGATCTTGAAGAAGAA pLKO.1 1260 CDS 100% 4.950 2.475 Y CTAGE4 n/a
20 TRCN0000005402 GCTATGAAGTAGAGTCATCTT pLKO.1 271 CDS 100% 4.950 2.475 Y CTAGE1 n/a
21 TRCN0000164371 CAAGATGAATTGATGGCGGAT pLKO.1 441 CDS 100% 2.160 1.080 Y CTAGE15 n/a
22 TRCN0000174282 CAGTTTAAGTAACTGCTGTTA pLKO.1 2419 3UTR 100% 0.495 0.248 Y n/a
23 TRCN0000148442 CCAGGACAATCATATCCTGAT pLKO.1 1785 CDS 100% 0.405 0.203 Y CTAGE6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536785.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10968 pDONR223 100% 99.3% 99.3% None 143_144insGGTAGAAAATCAAAT n/a
2 ccsbBroad304_10968 pLX_304 0% 99.3% 99.3% V5 143_144insGGTAGAAAATCAAAT n/a
3 TRCN0000475416 ATAGTTAGCGCAGAAAAGATACGG pLX_317 11.5% 99.3% 99.3% V5 143_144insGGTAGAAAATCAAAT n/a
4 ccsbBroadEn_10967 pDONR223 100% 89.4% 89.2% None (many diffs) n/a
5 ccsbBroad304_10967 pLX_304 0% 89.4% 89.2% V5 (many diffs) n/a
6 TRCN0000470328 CTTGCATGAATTTATTTTATTCTT pLX_317 13.8% 89.4% 89.2% V5 (many diffs) n/a
7 ccsbBroadEn_03960 pDONR223 100% 84.4% 79.8% None (many diffs) n/a
8 ccsbBroad304_03960 pLX_304 0% 84.4% 79.8% V5 (many diffs) n/a
9 TRCN0000469836 CGAATATCTAATGCTCGTTTGACG pLX_317 17.1% 84.4% 79.8% V5 (many diffs) n/a
10 ccsbBroadEn_13596 pDONR223 100% 84% 76.4% None (many diffs) n/a
11 ccsbBroad304_13596 pLX_304 0% 84% 76.4% V5 (many diffs) n/a
12 ccsbBroadEn_13076 pDONR223 100% 83.1% 78.2% None (many diffs) n/a
13 ccsbBroad304_13076 pLX_304 0% 83.1% 78.2% V5 (many diffs) n/a
14 TRCN0000481377 AACTAGAGAATGGGATCGGTCGAA pLX_317 19.7% 83.1% 78.2% V5 (many diffs) n/a
Download CSV