Transcript: Human XM_011542278.1

PREDICTED: Homo sapiens NBPF member 3 (NBPF3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NBPF3 (84224)
Length:
4199
CDS:
952..2685

Additional Resources:

NCBI RefSeq record:
XM_011542278.1
NBCI Gene record:
NBPF3 (84224)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542278.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412528 TGATCTGCCAGACATTCTAAT pLKO_005 2917 3UTR 100% 13.200 18.480 N NBPF3 n/a
2 TRCN0000412538 TATTCGACTACTTCAACTTAC pLKO_005 2506 CDS 100% 10.800 15.120 N NBPF3 n/a
3 TRCN0000424922 ACTCCTTTCAGTTATCCAGAA pLKO_005 2287 CDS 100% 4.050 2.835 N NBPF3 n/a
4 TRCN0000172787 GAGGAAGAACACGTTGGCTTT pLKO.1 2353 CDS 100% 4.050 2.835 N NBPF3 n/a
5 TRCN0000437519 TCAACGAGGTGCTGATGGAAG pLKO_005 2444 CDS 100% 4.050 2.835 N NBPF3 n/a
6 TRCN0000418316 ACACTAAGCAGCCCTTACTAA pLKO_005 2679 CDS 100% 5.625 3.375 N NBPF3 n/a
7 TRCN0000168761 GAAGACTGCAAAGACCTCATA pLKO.1 1132 CDS 100% 4.950 2.970 N NBPF3 n/a
8 TRCN0000172709 GCTCTTGACATAGGCAGACAT pLKO.1 1924 CDS 100% 4.950 2.970 N NBPF3 n/a
9 TRCN0000352961 CTGAGGAGCTCAGGCAATATA pLKO_005 1217 CDS 100% 15.000 7.500 Y NBPF11 n/a
10 TRCN0000255811 GAGGAGCTCAGGCAATATAAA pLKO_005 1219 CDS 100% 15.000 7.500 Y NBPF15 n/a
11 TRCN0000242329 TGAGGAGCTCAGGCAATATAA pLKO_005 1218 CDS 100% 15.000 7.500 Y NBPF9 n/a
12 TRCN0000161314 GACTCACTGGATAGATGTTAT pLKO.1 2488 CDS 100% 13.200 6.600 Y NBPF1 n/a
13 TRCN0000344135 GCATGTCTCTGAGCTTCTATA pLKO_005 2993 3UTR 100% 13.200 6.600 Y NBPF15 n/a
14 TRCN0000161288 GTGCCATCACTTGTTCAAATA pLKO.1 1571 CDS 100% 13.200 6.600 Y NBPF1 n/a
15 TRCN0000242432 TGTGCCATCACTTGTTCAAAT pLKO_005 1570 CDS 100% 13.200 6.600 Y NBPF11 n/a
16 TRCN0000244547 TTCCAGATGGGAGTCATATTC pLKO_005 2656 CDS 100% 13.200 6.600 Y NBPF11 n/a
17 TRCN0000242325 ACGAGAGCTGACCCAGTTAAG pLKO_005 1260 CDS 100% 10.800 5.400 Y NBPF9 n/a
18 TRCN0000172811 GCAGGACTCACTGGATAGATT pLKO.1 2034 CDS 100% 5.625 2.813 Y NBPF3 n/a
19 TRCN0000146474 CCTGAGTTTCATAGGAGGTAA pLKO.1 3438 3UTR 100% 4.950 2.475 Y NBPF15 n/a
20 TRCN0000163889 CCTGAGTTTCATAGGAGGTAA pLKO.1 3438 3UTR 100% 4.950 2.475 Y NBPF14 n/a
21 TRCN0000181020 CTGGATGAGAAAGAGCCTGAA pLKO.1 2008 CDS 100% 4.050 2.025 Y NBPF8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542278.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09966 pDONR223 100% 77.9% 69.1% None (many diffs) n/a
2 ccsbBroad304_09966 pLX_304 0% 77.9% 69.1% V5 (many diffs) n/a
3 TRCN0000476622 TTTTACCGTGCTGGCCAAGGACTT pLX_317 19.5% 77.9% 69.1% V5 (many diffs) n/a
4 ccsbBroadEn_12247 pDONR223 100% 68.5% 60.8% None (many diffs) n/a
5 ccsbBroad304_12247 pLX_304 0% 68.5% 60.8% V5 (many diffs) n/a
6 TRCN0000475390 TTACACTGAACGGGCTATGATCAG pLX_317 19.6% 68.5% 60.8% V5 (many diffs) n/a
7 TRCN0000469491 AAATCTAACGTTAGACAGGGAAAT pLX_317 16.1% 38% 34.1% V5 (not translated due to frame shift) (many diffs) n/a
8 ccsbBroadEn_15282 pDONR223 73.8% 35.3% 29.6% None (many diffs) n/a
9 ccsbBroad304_15282 pLX_304 0% 35.3% 29.6% V5 (many diffs) n/a
10 ccsbBroadEn_15343 pDONR223 79.7% 55.8% 49.9% None (many diffs) n/a
11 ccsbBroad304_15343 pLX_304 0% 55.8% 49.9% V5 (many diffs) n/a
12 TRCN0000476676 CTCGGTCCAAATACGACCGTGACC pLX_317 14.4% 55.8% 49.9% V5 (many diffs) n/a
13 ccsbBroadEn_12795 pDONR223 100% 43.5% 30.2% None (many diffs) n/a
14 ccsbBroad304_12795 pLX_304 0% 43.5% 30.2% V5 (many diffs) n/a
15 TRCN0000466247 ATCAGCAGGTCACACTGTTGAGTG pLX_317 41.2% 43.5% 30.2% V5 (many diffs) n/a
Download CSV