Transcript: Human XM_017011426.2

PREDICTED: Homo sapiens pre-mRNA processing factor 4B (PRPF4B), transcript variant X15, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRPF4B (8899)
Length:
5956
CDS:
98..3121

Additional Resources:

NCBI RefSeq record:
XM_017011426.2
NBCI Gene record:
PRPF4B (8899)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011426.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219889 CCTACTGATGATAAGGTTAAA pLKO.1 869 CDS 100% 13.200 18.480 N PRPF4B n/a
2 TRCN0000219890 ACCGATGCAGAAGGCTATTAT pLKO.1 2102 CDS 100% 15.000 10.500 N PRPF4B n/a
3 TRCN0000435706 ACTACAAAGAAACGAAGTAAA pLKO_005 632 CDS 100% 13.200 9.240 N PRPF4B n/a
4 TRCN0000426824 GCTTCACATGTTGCGGATAAT pLKO_005 2609 CDS 100% 13.200 9.240 N PRPF4B n/a
5 TRCN0000196256 GCATCTTATATTCACCCTTAA pLKO.1 5067 3UTR 100% 10.800 7.560 N PRPF4B n/a
6 TRCN0000000719 CCCTATCAACTGTCTTATGTA pLKO.1 4662 3UTR 100% 5.625 3.938 N PRPF4B n/a
7 TRCN0000196436 GCTATGACTATGGTATAGATA pLKO.1 2691 CDS 100% 5.625 3.938 N PRPF4B n/a
8 TRCN0000000722 GAATGAAAGTTGAGCAGGAAT pLKO.1 1629 CDS 100% 4.950 3.465 N PRPF4B n/a
9 TRCN0000000720 GCTGCTGATGTTAAAGAGTAT pLKO.1 1862 CDS 100% 4.950 3.465 N PRPF4B n/a
10 TRCN0000196516 GAAGATGAAGAAGCCCTAATA pLKO.1 1691 CDS 100% 13.200 7.920 N PRPF4B n/a
11 TRCN0000000721 CTCAAGATCAAGCAAGGAAAT pLKO.1 792 CDS 100% 10.800 6.480 N PRPF4B n/a
12 TRCN0000000723 AGCAAGTCAAAGGAGAGGAAA pLKO.1 740 CDS 100% 4.950 2.970 N PRPF4B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011426.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492284 AATCCATTCTCGATCTTGGTCAAC pLX_317 11.2% 99.9% 99.9% V5 (not translated due to prior stop codon) 247A>G n/a
2 TRCN0000477049 GATGGTCCCCGTGCCAATGTATCA pLX_317 12.4% 99.8% 99.5% V5 (many diffs) n/a
3 ccsbBroadEn_07328 pDONR223 100% 99.8% 99.4% None (many diffs) n/a
4 ccsbBroad304_07328 pLX_304 0% 99.8% 99.4% V5 (many diffs) n/a
5 ccsbBroadEn_14919 pDONR223 52.4% 99.5% 25.9% None (many diffs) n/a
6 ccsbBroad304_14919 pLX_304 0% 99.5% 25.9% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000470684 TTAGATAGTCGATTAGTACGTATA pLX_317 12.4% 99.5% 25.9% V5 (not translated due to prior stop codon) (many diffs) n/a
8 ccsbBroadEn_15340 pDONR223 100% 10.4% 10.5% None 1_2703del;3000C>T n/a
9 ccsbBroad304_15340 pLX_304 0% 10.4% 10.5% V5 1_2703del;3000C>T n/a
10 TRCN0000468046 ACGTATCCAGTATGTTCTCCACTG pLX_317 100% 10.4% 10.5% V5 1_2703del;3000C>T n/a
11 TRCN0000480281 ATGCACTGTTTCTGCACAACGACC pLX_317 100% 10.4% 10.5% V5 1_2703del;3000C>T n/a
Download CSV