Transcript: Human XM_017018156.1

PREDICTED: Homo sapiens serine/threonine kinase 33 (STK33), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STK33 (65975)
Length:
2365
CDS:
181..1725

Additional Resources:

NCBI RefSeq record:
XM_017018156.1
NBCI Gene record:
STK33 (65975)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018156.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229974 GAAACGAAGTGGGCAATTAAA pLKO_005 595 CDS 100% 15.000 21.000 N STK33 n/a
2 TRCN0000229977 GTCGTAATGTACATGTTATTA pLKO_005 1111 CDS 100% 15.000 21.000 N STK33 n/a
3 TRCN0000382487 ATAAACTTGCCATACGTATTA pLKO_005 2167 3UTR 100% 13.200 18.480 N STK33 n/a
4 TRCN0000382192 CAACCAAGTACCCTGCTAAAT pLKO_005 1670 CDS 100% 13.200 18.480 N STK33 n/a
5 TRCN0000195277 CGTCGTAATGTACATGTTATT pLKO.1 1110 CDS 100% 13.200 18.480 N STK33 n/a
6 TRCN0000229976 TTATCAGTGCCCACGACTATA pLKO_005 1061 CDS 100% 13.200 18.480 N STK33 n/a
7 TRCN0000229975 CTCGCATCAGCTATAGCATAT pLKO_005 844 CDS 100% 10.800 15.120 N STK33 n/a
8 TRCN0000196915 GCCATACGTATTACAGCAGAA pLKO.1 2175 3UTR 100% 4.050 5.670 N STK33 n/a
9 TRCN0000218466 ATGTTTAGGCACAGCTATTTA pLKO_005 2057 3UTR 100% 15.000 12.000 N STK33 n/a
10 TRCN0000382280 GTAATGGAGGTGCCAAATAAT pLKO_005 2104 3UTR 100% 15.000 12.000 N STK33 n/a
11 TRCN0000196819 GCCAAATAATTATGTGCACTT pLKO.1 2115 3UTR 100% 4.050 3.240 N STK33 n/a
12 TRCN0000381374 TAAGCTGCACATGGCATTAAA pLKO_005 1902 3UTR 100% 15.000 10.500 N STK33 n/a
13 TRCN0000379525 AGCAGTCTTATTGATGATAAC pLKO_005 922 CDS 100% 10.800 7.560 N STK33 n/a
14 TRCN0000380970 ATGAGACAAGGTGGATCATTC pLKO_005 818 CDS 100% 10.800 7.560 N STK33 n/a
15 TRCN0000196452 GCTAAGGAACTACTAGATAAC pLKO.1 1294 CDS 100% 10.800 7.560 N STK33 n/a
16 TRCN0000382463 TTGAACGAGAGGTGAACATTC pLKO_005 659 CDS 100% 10.800 7.560 N STK33 n/a
17 TRCN0000002080 CCCTCAAGAACCTCAAATGTA pLKO.1 406 CDS 100% 5.625 3.938 N STK33 n/a
18 TRCN0000002077 CCAAGGAACAGCAACCAAGTA pLKO.1 1659 CDS 100% 4.950 3.465 N STK33 n/a
19 TRCN0000002078 GCAGTTCAAGTTTCACATCTA pLKO.1 1580 CDS 100% 4.950 3.465 N STK33 n/a
20 TRCN0000002081 CTTGCCATTAACTTGCTGCTA pLKO.1 2296 3UTR 100% 2.640 1.848 N STK33 n/a
21 TRCN0000002079 GAACACATCATACATCTGGAA pLKO.1 697 CDS 100% 2.640 1.848 N STK33 n/a
22 TRCN0000221229 GCAGTGTGACATTTGGAGCAT pLKO.1 1086 CDS 100% 2.640 1.848 N Stk33 n/a
23 TRCN0000380779 GGAGCTTTGGAATAGTCATTG pLKO_005 554 CDS 100% 10.800 6.480 N STK33 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018156.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489906 ATAATGCAGGTGGGCCGATGTCAA pLX_317 25.7% 100% 100% V5 (not translated due to prior stop codon) n/a
2 ccsbBroadEn_12518 pDONR223 100% 99.6% 99.4% None (many diffs) n/a
3 ccsbBroad304_12518 pLX_304 0% 99.6% 99.4% V5 (many diffs) n/a
4 TRCN0000473158 TACTAGCTGGGAAAGTGCGCCAGC pLX_317 30.7% 99.6% 99.4% V5 (many diffs) n/a
5 ccsbBroadEn_15143 pDONR223 0% 99.6% 99.4% None (many diffs) n/a
6 ccsbBroad304_15143 pLX_304 0% 99.6% 99.4% V5 (many diffs) n/a
7 TRCN0000474291 AACACGCGGGGAGCCTCGGCCTTA pLX_317 34.3% 99.5% 99.2% V5 (many diffs) n/a
8 TRCN0000489525 CCCTGATCTCATCTGTTTTTCAGT pLX_317 25.9% 99.6% 99.4% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000488757 GGTGGCTATACACACTGAAACTCT pLX_317 22.4% 99.5% 99.2% V5 (many diffs) n/a
Download CSV