Transcript: Human XM_017021880.2

PREDICTED: Homo sapiens cancer susceptibility 4 (CASC4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CASC4 (113201)
Length:
1164
CDS:
322..1143

Additional Resources:

NCBI RefSeq record:
XM_017021880.2
NBCI Gene record:
CASC4 (113201)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021880.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135209 CGTCAGGAATTTCTTCGACAA pLKO.1 721 CDS 100% 4.050 3.240 N CASC4 n/a
2 TRCN0000136384 CAAGAAACAGATCGACCAGAA pLKO.1 552 CDS 100% 4.050 2.835 N CASC4 n/a
3 TRCN0000136229 GAATGAAGAACCCTCAAGCAA pLKO.1 1002 CDS 100% 3.000 2.100 N CASC4 n/a
4 TRCN0000136961 GCACAAGAAACAGATCGACCA pLKO.1 549 CDS 100% 2.160 1.512 N CASC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021880.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13018 pDONR223 100% 64.8% 60.5% None 482_572del;623_819del n/a
2 ccsbBroad304_13018 pLX_304 0% 64.8% 60.5% V5 482_572del;623_819del n/a
3 TRCN0000469243 GCCAGGCACGATAAGACGATTGTG pLX_317 60.6% 64.8% 60.5% V5 482_572del;623_819del n/a
4 ccsbBroadEn_13019 pDONR223 100% 61.8% 61.4% None (many diffs) n/a
5 ccsbBroad304_13019 pLX_304 0% 61.8% 61.4% V5 (many diffs) n/a
6 TRCN0000478915 AAGTGCTATTCTTCTGGTCCATGC pLX_317 27.5% 61.8% 61.4% V5 (many diffs) n/a
Download CSV