Transcript: Human XM_017027961.1

PREDICTED: Homo sapiens p21 (RAC1) activated kinase 5 (PAK5), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PAK5 (57144)
Length:
4941
CDS:
710..2869

Additional Resources:

NCBI RefSeq record:
XM_017027961.1
NBCI Gene record:
PAK5 (57144)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146752 GGAGGGGTGATGGTACAAGG pXPR_003 TGG 1144 53% 8 0.6643 PAK5 PAK5 75713
2 BRDN0001147115 GGATGGGTGTGATGCATGAA pXPR_003 GGG 170 8% 6 0.5808 PAK5 PAK5 75714
3 BRDN0001149524 TTGGAATGAATAATCCAGAG pXPR_003 GGG 682 32% 7 0.211 PAK5 PAK5 75715
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027961.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356269 GATGATCTGGATCCGTATTAT pLKO_005 1169 CDS 100% 15.000 21.000 N PAK5 n/a
2 TRCN0000007111 CCGGATAAAGTTGTCTGATTT pLKO.1 2449 CDS 100% 13.200 18.480 N PAK5 n/a
3 TRCN0000362387 GACAAGCGATGGCCGGATAAA pLKO_005 2437 CDS 100% 13.200 18.480 N Pak7 n/a
4 TRCN0000378210 GACAAGCGATGGCCGGATAAA pLKO_005 2437 CDS 100% 13.200 18.480 N PAK5 n/a
5 TRCN0000378187 GGGAATACTTGGCCAACTTTA pLKO_005 2046 CDS 100% 13.200 18.480 N PAK5 n/a
6 TRCN0000007109 GCTCCTATGAAGACAATCGTT pLKO.1 902 CDS 100% 3.000 4.200 N PAK5 n/a
7 TRCN0000195471 CGGGATCATGGTGATAGAAAT pLKO.1 2596 CDS 100% 13.200 10.560 N PAK5 n/a
8 TRCN0000007108 CGGGATTACCACCATGACAAT pLKO.1 2204 CDS 100% 4.950 3.960 N PAK5 n/a
9 TRCN0000007110 GCCAAAGTCTTCGTACCTGAA pLKO.1 1510 CDS 100% 4.050 3.240 N PAK5 n/a
10 TRCN0000007107 GCCTCCATAAATATGATCTAT pLKO.1 4515 3UTR 100% 5.625 3.938 N PAK5 n/a
11 TRCN0000025169 GCCCACAATGTGCATTCCAAA pLKO.1 1678 CDS 100% 4.950 3.465 N Pak7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027961.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492001 ACCAAGCTCAGTTCCCCAATTCTT pLX_317 20.4% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000489786 AGTCCAGCTCTGGGATATCCCCCT pLX_317 12.7% 99.9% 99.8% V5 2157_2158insG n/a
3 ccsbBroadEn_08707 pDONR223 100% 99.8% 99.7% None 79C>G;1208C>A;2127C>T n/a
4 ccsbBroad304_08707 pLX_304 0% 99.8% 99.7% V5 79C>G;1208C>A;2127C>T n/a
5 TRCN0000475334 GCTGCATCGACTAAAAGGCGAGCC pLX_317 15.2% 99.8% 99.7% V5 79C>G;1208C>A;2127C>T n/a
6 ccsbBroadEn_15120 pDONR223 0% 99.8% 99.7% None 79C>G;1208C>A;2127C>T n/a
7 ccsbBroad304_15120 pLX_304 0% 99.8% 99.7% V5 79C>G;1208C>A;2127C>T n/a
8 TRCN0000471919 TTCACAAAGACGCGCTTACACAGA pLX_317 18.5% 99.8% 99.7% V5 79C>G;1208C>A;2127C>T n/a
9 TRCN0000487983 GCAAGTCAACACTGGCGGTTTTAG pLX_317 14.1% 98.5% 98.4% V5 (not translated due to prior stop codon) 1532G>A;1837_1866del n/a
10 TRCN0000489367 GCCTTACCTGATAATTGCTTTTCG pLX_317 17.3% 98.5% 98.3% V5 1532G>A;1837_1866del;2157_2158insG n/a
Download CSV