Transcript: Mouse XM_017314241.1

PREDICTED: Mus musculus calcium/calmodulin-dependent protein kinase II, beta (Camk2b), transcript variant X13, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Camk2b (12323)
Length:
4391
CDS:
686..2206

Additional Resources:

NCBI RefSeq record:
XM_017314241.1
NBCI Gene record:
Camk2b (12323)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314241.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012473 CCACCTTGTTATCTCCACAAA pLKO.1 4072 3UTR 100% 4.950 3.465 N Camk2b n/a
2 TRCN0000319741 CCACCTTGTTATCTCCACAAA pLKO_005 4072 3UTR 100% 4.950 3.465 N Camk2b n/a
3 TRCN0000012475 CCTGCTGAAGCATTCCAACAT pLKO.1 133 5UTR 100% 4.950 3.465 N Camk2b n/a
4 TRCN0000319747 CCTGCTGAAGCATTCCAACAT pLKO_005 133 5UTR 100% 4.950 3.465 N Camk2b n/a
5 TRCN0000012476 GACTGTGGAATGTCTGAAGAA pLKO.1 1060 CDS 100% 4.950 3.465 N Camk2b n/a
6 TRCN0000319748 GACTGTGGAATGTCTGAAGAA pLKO_005 1060 CDS 100% 4.950 3.465 N Camk2b n/a
7 TRCN0000012477 CTGACCTCATTTGAGCCTGAA pLKO.1 1898 CDS 100% 4.050 2.835 N Camk2b n/a
8 TRCN0000350177 CTGACCTCATTTGAGCCTGAA pLKO_005 1898 CDS 100% 4.050 2.835 N Camk2b n/a
9 TRCN0000000469 ACAAGAAAGCAGATGGAGTCA pLKO.1 1242 CDS 100% 2.640 1.848 N CAMK2B n/a
10 TRCN0000199539 CGCATGTTTGTGTCTGCCTCG pLKO.1 2280 3UTR 100% 0.400 0.280 N CAMK2B n/a
11 TRCN0000000470 ATCTCTGACATCCTGAACTCT pLKO.1 1553 CDS 100% 3.000 3.900 N CAMK2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314241.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488486 GACCTCCTCAAGAGGCAACGCTGC pLX_317 10.9% 51.8% 51.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489411 AAGTGGCATAGCCCCCTCAAGCTG pLX_317 20.6% 51.8% 51.1% V5 (many diffs) n/a
3 ccsbBroadEn_14563 pDONR223 93.6% 46.1% 45.4% None (many diffs) n/a
4 ccsbBroad304_14563 pLX_304 0% 46.1% 45.4% V5 (many diffs) n/a
5 TRCN0000468031 AGCATTTCATGGTGGACCTTTAGT pLX_317 28.9% 43.4% 42.4% V5 (not translated due to frame shift) (many diffs) n/a
6 ccsbBroadEn_14564 pDONR223 0% 46.1% 45.4% None (many diffs) n/a
7 ccsbBroad304_14564 pLX_304 0% 46.1% 45.4% V5 (many diffs) n/a
8 TRCN0000480225 GACAGTGGGGGTGATCTCGGAGCG pLX_317 22.3% 46.1% 45.4% V5 (many diffs) n/a
Download CSV