Transcript: Mouse XM_017315851.1

PREDICTED: Mus musculus heterogeneous nuclear ribonucleoprotein C (Hnrnpc), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hnrnpc (15381)
Length:
1718
CDS:
168..1088

Additional Resources:

NCBI RefSeq record:
XM_017315851.1
NBCI Gene record:
Hnrnpc (15381)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315851.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112058 GCCTTTGTCCAGTATGTTAAT pLKO.1 324 CDS 100% 13.200 18.480 N Hnrnpc n/a
2 TRCN0000334963 GCCTTTGTCCAGTATGTTAAT pLKO_005 324 CDS 100% 13.200 18.480 N Hnrnpc n/a
3 TRCN0000112059 CCTGCTGGATGATGACGATAA pLKO.1 965 CDS 100% 10.800 7.560 N Hnrnpc n/a
4 TRCN0000112057 CAGTAGAGATGAAGAATGAAA pLKO.1 844 CDS 100% 5.625 3.938 N Hnrnpc n/a
5 TRCN0000112055 GCTTAGAAATCTTATCCCATT pLKO.1 1101 3UTR 100% 4.050 2.835 N Hnrnpc n/a
6 TRCN0000334964 GCTTAGAAATCTTATCCCATT pLKO_005 1101 3UTR 100% 4.050 2.835 N Hnrnpc n/a
7 TRCN0000011038 GCGGAGATGTACGGGTCAGTA pLKO.1 471 CDS 100% 1.650 1.155 N HNRNPC n/a
8 TRCN0000348398 CCTCTACTCAGTTCCTCATTT pLKO_005 513 CDS 100% 13.200 7.920 N Hnrnpc n/a
9 TRCN0000348397 TGATGACCTTCAGGCCATTAA pLKO_005 740 CDS 100% 13.200 7.920 N Hnrnpc n/a
10 TRCN0000112056 CCCTCTACTCAGTTCCTCATT pLKO.1 512 CDS 100% 4.950 2.970 N Hnrnpc n/a
11 TRCN0000239537 GATGACCTTCAGGCCATTAAG pLKO_005 741 CDS 100% 13.200 9.240 N HNRNPCL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315851.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06387 pDONR223 100% 92.8% 97% None (many diffs) n/a
2 ccsbBroad304_06387 pLX_304 0% 92.8% 97% V5 (many diffs) n/a
3 TRCN0000473030 TTGCTACGTAGGGTTTTTCAAGGC pLX_317 52.1% 92.8% 97% V5 (many diffs) n/a
4 ccsbBroadEn_13871 pDONR223 100% 88.8% 34.6% None (many diffs) n/a
5 ccsbBroad304_13871 pLX_304 0% 88.8% 34.6% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_15449 pDONR223 0% 88.8% 93.4% None (many diffs) n/a
7 ccsbBroad304_15449 pLX_304 0% 88.8% 93.4% V5 (many diffs) n/a
8 TRCN0000469153 TTAATGTCGATCTGAGGGCATCCG pLX_317 42.7% 88.8% 93.4% V5 (many diffs) n/a
9 ccsbBroadEn_15450 pDONR223 0% 88.5% 92.8% None (many diffs) n/a
10 ccsbBroad304_15450 pLX_304 0% 88.5% 92.8% V5 (many diffs) n/a
11 TRCN0000470594 TAAACACACACACGGATGCCGTTA pLX_317 42.9% 88.5% 92.8% V5 (many diffs) n/a
12 ccsbBroadEn_10043 pDONR223 100% 84.5% 85% None (many diffs) n/a
13 ccsbBroad304_10043 pLX_304 0% 84.5% 85% V5 (many diffs) n/a
14 TRCN0000478014 ATTTTTTGTTACGCAATAGTATCC pLX_317 6.2% 84.5% 85% V5 (many diffs) n/a
15 ccsbBroadEn_10165 pDONR223 100% 83.2% 82.7% None (many diffs) n/a
16 ccsbBroad304_10165 pLX_304 0% 83.2% 82.7% V5 (many diffs) n/a
17 TRCN0000477352 GAGCCTAGTGTCAGGTTCCGGTGG pLX_317 39% 83.2% 82.7% V5 (many diffs) n/a
Download CSV