Transcript: Human XM_024446748.1

PREDICTED: Homo sapiens zinc finger protein 680 (ZNF680), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF680 (340252)
Length:
2810
CDS:
511..1527

Additional Resources:

NCBI RefSeq record:
XM_024446748.1
NBCI Gene record:
ZNF680 (340252)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446748.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436833 TAATGGGTGCTCCAGCCTTAC pLKO_005 1179 CDS 100% 6.000 8.400 N ZNF680 n/a
2 TRCN0000107338 GCCTGCAACTCTTGCTAATCA pLKO.1 1353 CDS 100% 5.625 7.875 N ZNF680 n/a
3 TRCN0000414227 GGAGCATAGGAGGGTTGTAGT pLKO_005 1912 3UTR 100% 4.950 6.930 N ZNF680 n/a
4 TRCN0000412700 CAATGATTGTTACACTTGCTT pLKO_005 1600 3UTR 100% 3.000 4.200 N ZNF680 n/a
5 TRCN0000430843 GACAAAGCCTTCCAATGATTG pLKO_005 1588 3UTR 100% 10.800 7.560 N ZNF680 n/a
6 TRCN0000107336 CCTGCAACTCTTGCTAATCAT pLKO.1 1354 CDS 100% 5.625 3.938 N ZNF680 n/a
7 TRCN0000107339 GAGTCTAAGGTGTTCAAAGAA pLKO.1 325 5UTR 100% 5.625 3.938 N ZNF680 n/a
8 TRCN0000425071 ACTTAACCAATACTCACATCT pLKO_005 1677 3UTR 100% 4.950 3.465 N ZNF680 n/a
9 TRCN0000431972 CATCCTGTTGAGAAACCCTAA pLKO_005 1552 3UTR 100% 4.050 2.835 N ZNF680 n/a
10 TRCN0000422607 GCAAAGTTCTTAACTGGTTCT pLKO_005 581 CDS 100% 4.050 2.835 N ZNF680 n/a
11 TRCN0000107335 GCACTGACACTTTAGACATTA pLKO.1 2211 3UTR 100% 13.200 7.920 N ZNF680 n/a
12 TRCN0000435876 CATCTAACACAACATATAAGA pLKO_005 520 CDS 100% 5.625 3.375 N ZNF680 n/a
13 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 968 CDS 100% 13.200 6.600 Y Zfp934 n/a
14 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 968 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
15 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 968 CDS 100% 13.200 6.600 Y EG668616 n/a
16 TRCN0000019457 CCTCACACCTTACTAGACATA pLKO.1 1439 CDS 100% 4.950 2.475 Y ZNF681 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446748.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10024 pDONR223 100% 63.5% 63.3% None (many diffs) n/a
2 ccsbBroad304_10024 pLX_304 0% 63.5% 63.3% V5 (many diffs) n/a
3 TRCN0000466950 AAAAATGGGCGCTCTGAGACACAC pLX_317 21.1% 63.5% 63.3% V5 (many diffs) n/a
4 ccsbBroadEn_09774 pDONR223 100% 55.7% 46.8% None (many diffs) n/a
5 ccsbBroad304_09774 pLX_304 0% 55.7% 46.8% V5 (many diffs) n/a
6 TRCN0000472815 CCTGACTCCCTTTAAGTGTTCGTG pLX_317 27.4% 55.7% 46.8% V5 (many diffs) n/a
7 ccsbBroadEn_11232 pDONR223 100% 53.7% 45.8% None (many diffs) n/a
8 ccsbBroad304_11232 pLX_304 0% 53.7% 45.8% V5 (many diffs) n/a
9 TRCN0000476048 TACTATCCCAATAGAAACACCTCC pLX_317 21.8% 53.7% 45.8% V5 (many diffs) n/a
10 ccsbBroadEn_15278 pDONR223 59.5% 49.2% 41.1% None (many diffs) n/a
11 ccsbBroad304_15278 pLX_304 0% 49.2% 41.1% V5 (many diffs) n/a
12 ccsbBroadEn_15167 pDONR223 53.6% 47.5% 18.4% None (many diffs) n/a
13 ccsbBroad304_15167 pLX_304 0% 47.5% 18.4% V5 (not translated due to prior stop codon) (many diffs) n/a
14 ccsbBroadEn_07157 pDONR223 100% 35.6% 29.4% None (many diffs) n/a
15 ccsbBroad304_07157 pLX_304 0% 35.6% 29.4% V5 (many diffs) n/a
16 TRCN0000475452 TAAAACTTCAACTTGGTTTCCTTC pLX_317 10.2% 35.6% 29.4% V5 (many diffs) n/a
Download CSV