Transcript: Human XM_024449992.1

PREDICTED: Homo sapiens olfactory receptor family 4 subfamily F member 16 (OR4F16), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OR4F16 (81399)
Length:
5240
CDS:
2496..3434

Additional Resources:

NCBI RefSeq record:
XM_024449992.1
NBCI Gene record:
OR4F16 (81399)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449992.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184968 CAACTGGCATTTCTTGTTAAT pLKO.1 2970 CDS 100% 13.200 6.600 Y OR4F16 n/a
2 TRCN0000203890 CCTACGTCTTCATCCTGTTTA pLKO.1 3145 CDS 100% 13.200 6.600 Y OR4F16 n/a
3 TRCN0000194281 GCAGTTCATGGTCACTGTTAA pLKO.1 3080 CDS 100% 13.200 6.600 Y OR4F3 n/a
4 TRCN0000204779 GCCATGGCCTTTGACAGATAT pLKO.1 2844 CDS 100% 13.200 6.600 Y OR4F3 n/a
5 TRCN0000187922 GTCCACCCATGTTTGTGTATA pLKO.1 3250 CDS 100% 13.200 6.600 Y OR4F16 n/a
6 TRCN0000188193 CCCTCCACTATCTGACCATTA pLKO.1 2881 CDS 100% 10.800 5.400 Y OR4F16 n/a
7 TRCN0000187242 CCCAAGAATGTGCCTTTCATT pLKO.1 2906 CDS 100% 5.625 2.813 Y OR4F16 n/a
8 TRCN0000186943 CATCGCTCAAATCTTCTTCAT pLKO.1 2786 CDS 100% 4.950 2.475 Y OR4F3 n/a
9 TRCN0000188228 CTCTGTCACTTCTCCCAAGAT pLKO.1 2717 CDS 100% 4.950 2.475 Y OR4F21 n/a
10 TRCN0000203644 CTGTGTGGGTACTTTCTTCAT pLKO.1 3113 CDS 100% 4.950 2.475 Y OR4F16 n/a
11 TRCN0000204122 GCATCGCTCAAATCTTCTTCA pLKO.1 2785 CDS 100% 4.950 2.475 Y OR4F16 n/a
12 TRCN0000189019 GCCACACCCTAATTCACAGAT pLKO.1 3275 CDS 100% 4.950 2.475 Y OR4F16 n/a
13 TRCN0000188743 GTGCTCTATGTGGCAAGCATT pLKO.1 2592 CDS 100% 4.950 2.475 Y OR4F16 n/a
14 TRCN0000187988 GTTCAGAAAGCGCAAAGTCAT pLKO.1 2750 CDS 100% 4.950 2.475 Y OR4F21 n/a
15 TRCN0000185909 CAAGATGATTTATGACCTGTT pLKO.1 2732 CDS 100% 4.050 2.025 Y OR4F3 n/a
16 TRCN0000203361 CATTACTGGAAACATCCTCAT pLKO.1 2609 CDS 100% 4.050 2.025 Y OR4F3 n/a
17 TRCN0000186384 CATCCTGTTTACTGTTTGGAA pLKO.1 3155 CDS 100% 3.000 1.500 Y OR4F21 n/a
18 TRCN0000189299 CCCTAATGTGTTGGACAGCTT pLKO.1 3005 CDS 100% 2.640 1.320 Y OR4F16 n/a
19 TRCN0000203863 CGCTCAAATCTTCTTCATCCA pLKO.1 2789 CDS 100% 2.640 1.320 Y OR4F16 n/a
20 TRCN0000185202 CTTCATACTTCTAATCTCCTA pLKO.1 3128 CDS 100% 2.640 1.320 Y OR4F3 n/a
21 TRCN0000189022 GACAGCTTCTACTGTGACCTT pLKO.1 3018 CDS 100% 2.640 1.320 Y Olfr1307 n/a
22 TRCN0000186244 CACTGTTAACAGTGGGTTTAT pLKO.1 3092 CDS 100% 1.320 0.660 Y OR4F21 n/a
23 TRCN0000188313 CGCAAAGTCATCTCCTTTGGA pLKO.1 2760 CDS 100% 0.300 0.150 Y OR4F21 n/a
24 TRCN0000202738 CCAAGATGATTTATGACCTTT pLKO.1 2731 CDS 100% 4.950 2.475 Y OR4F6 n/a
25 TRCN0000203396 CCATGTACTTTCTACTGGCTA pLKO.1 2668 CDS 100% 2.640 1.320 Y Olfr1305 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449992.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09062 pDONR223 100% 99.8% 99.6% None 319G>A n/a
2 ccsbBroad304_09062 pLX_304 0% 99.8% 99.6% V5 319G>A n/a
3 TRCN0000475766 CGGTACCTTTTCTCAGCCGGACAT pLX_317 28.2% 99.8% 99.6% V5 319G>A n/a
Download CSV