Transcript: Human XM_024450552.1

PREDICTED: Homo sapiens tousled like kinase 2 (TLK2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TLK2 (11011)
Length:
5406
CDS:
156..2495

Additional Resources:

NCBI RefSeq record:
XM_024450552.1
NBCI Gene record:
TLK2 (11011)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450552.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322129 GCTGGTACTTATTGGTATTTA pLKO_005 2088 CDS 100% 15.000 21.000 N Tlk2 n/a
2 TRCN0000356159 GCTGGTACTTATTGGTATTTA pLKO_005 2088 CDS 100% 15.000 21.000 N TLK2 n/a
3 TRCN0000002361 GCAAGACATCCTACAAGAGAA pLKO.1 2237 CDS 100% 4.950 6.930 N TLK2 n/a
4 TRCN0000002363 CGGATTCATAAAGAGCTGGAT pLKO.1 1722 CDS 100% 2.640 3.696 N TLK2 n/a
5 TRCN0000356116 TGACCTCAAACCAGGTAATAT pLKO_005 1949 CDS 100% 15.000 10.500 N TLK2 n/a
6 TRCN0000195682 CACAAGGTGCTGGTACTTATT pLKO.1 2080 CDS 100% 13.200 9.240 N TLK2 n/a
7 TRCN0000356144 TAGGGAATACCGGATTCATAA pLKO_005 1712 CDS 100% 13.200 9.240 N TLK2 n/a
8 TRCN0000002362 TCTACATATCAGGGAACTAAA pLKO.1 1481 CDS 100% 13.200 9.240 N TLK2 n/a
9 TRCN0000002364 CAGTGAAGTTTACAAGGCATT pLKO.1 1595 CDS 100% 4.050 2.835 N TLK2 n/a
10 TRCN0000002365 TGGTGTTTGACTTCGGAGGAA pLKO.1 2980 3UTR 100% 2.640 1.848 N TLK2 n/a
11 TRCN0000356114 ACGATCCTCACCGCAACATTC pLKO_005 500 CDS 100% 10.800 5.400 Y TLK2 n/a
12 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3793 3UTR 100% 4.950 2.475 Y ERAP2 n/a
13 TRCN0000195560 CCACTTAATAGTGAGTCTTCC pLKO.1 261 CDS 100% 4.050 2.025 Y TLK2 n/a
14 TRCN0000027013 GCAACCAATGAGCAGAAACAA pLKO.1 1242 CDS 100% 5.625 3.938 N Tlk2 n/a
15 TRCN0000322066 GCAACCAATGAGCAGAAACAA pLKO_005 1242 CDS 100% 5.625 3.938 N Tlk2 n/a
16 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3794 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450552.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11580 pDONR223 100% 98.9% 98.9% None 1_24del n/a
2 ccsbBroad304_11580 pLX_304 0% 98.9% 98.9% V5 1_24del n/a
3 TRCN0000478401 TTACCGGTATGCAGATCCGGTTTT pLX_317 11.1% 98.9% 98.9% V5 1_24del n/a
4 ccsbBroadEn_14984 pDONR223 0% 98.9% 98.9% None 1_24del n/a
5 ccsbBroad304_14984 pLX_304 0% 98.9% 98.9% V5 1_24del n/a
6 TRCN0000474191 TTCGATGTTAGGTGTGTATCGATA pLX_317 18.7% 98.9% 98.9% V5 1_24del n/a
7 TRCN0000487715 TATTTCCAATGAACCAGATCAATC pLX_317 11.4% 96.2% 96.2% V5 (not translated due to prior stop codon) 1_21del;1143_1208del n/a
8 TRCN0000489119 TACCTGTAGTGACCTCCCATAAGG pLX_317 13.2% 96.2% 96.2% V5 (not translated due to prior stop codon) 1_21del;1143_1208del n/a
9 TRCN0000488113 TATTTTACTACGACAAAGTGCAGT pLX_317 11.3% 96.2% 96.1% V5 1_21del;1143_1208del;2337_2338insG n/a
10 TRCN0000491778 AGGCAAGCATAGGGACCATCCCTT pLX_317 16.4% 96.2% 96.1% V5 1_21del;1143_1208del;2337_2338insG n/a
Download CSV