Transcript: Human XM_024451397.1

PREDICTED: Homo sapiens zinc finger protein 320 (ZNF320), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF320 (162967)
Length:
3992
CDS:
272..1042

Additional Resources:

NCBI RefSeq record:
XM_024451397.1
NBCI Gene record:
ZNF320 (162967)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451397.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021905 GACGTGATGCTGGAGAATTAT pLKO.1 374 CDS 100% 15.000 7.500 Y ZNF765 n/a
2 TRCN0000021906 CCCTGCTCAGAGGACTCTATA pLKO.1 349 CDS 100% 13.200 6.600 Y ZNF765 n/a
3 TRCN0000021908 TCAGGGATGTGGCCATAGAAT pLKO.1 300 CDS 100% 5.625 2.813 Y ZNF765 n/a
4 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3291 3UTR 100% 4.950 2.475 Y ERAP2 n/a
5 TRCN0000015885 GCAATTCATACTGGAGAGAAA pLKO.1 622 CDS 100% 4.950 2.475 Y ZNF702P n/a
6 TRCN0000012914 GCGAACTCATACTGGAGAGAA pLKO.1 1448 3UTR 100% 4.950 2.475 Y ZNF137P n/a
7 TRCN0000021907 GCTGGAGAATTATAGGAACCT pLKO.1 382 CDS 100% 2.640 1.320 Y ZNF765 n/a
8 TRCN0000165704 CAATGGCACAATCTTGGCTCA pLKO.1 2921 3UTR 100% 2.160 1.080 Y LOC652276 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1881 3UTR 100% 13.200 6.600 Y LIAS n/a
10 TRCN0000147979 GCAATTCATACTGGAGAGAAT pLKO.1 622 CDS 100% 4.950 2.475 Y ZNF321P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451397.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05120 pDONR223 100% 40.1% 23.3% None (many diffs) n/a
2 ccsbBroad304_05120 pLX_304 0% 40.1% 23.3% V5 (many diffs) n/a
3 TRCN0000475531 CGCGGTATGATTAGCATATCCGAT pLX_317 14.1% 40.1% 23.3% V5 (many diffs) n/a
4 ccsbBroadEn_14339 pDONR223 100% 20.9% 1.1% None (many diffs) n/a
5 ccsbBroad304_14339 pLX_304 0% 20.9% 1.1% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000478280 ACGAGTTCACTGTCATGACCAACC pLX_317 100% 20.9% 1.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV