Transcript: Human XR_001743167.1

PREDICTED: Homo sapiens peptidase M20 domain containing 2 (PM20D2), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PM20D2 (135293)
Length:
4590
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001743167.1
NBCI Gene record:
PM20D2 (135293)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001743167.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419803 AGCCTATGGAAAGCCTATATG pLKO_005 941 3UTR 100% 13.200 18.480 N PM20D2 n/a
2 TRCN0000424221 ATCCGTACTTGATAGGATTAT pLKO_005 1471 3UTR 100% 13.200 9.240 N PM20D2 n/a
3 TRCN0000421516 GAGATTTCAAACCTTATATTC pLKO_005 1670 3UTR 100% 13.200 9.240 N PM20D2 n/a
4 TRCN0000430784 TCAAGAAGAACAGTTTGTAAA pLKO_005 1255 3UTR 100% 13.200 9.240 N PM20D2 n/a
5 TRCN0000413084 ATCTAATGCCTTGAATCATAC pLKO_005 1090 3UTR 100% 10.800 7.560 N PM20D2 n/a
6 TRCN0000148358 CCAGATATGGCTGAACATGAT pLKO.1 727 3UTR 100% 4.950 3.465 N PM20D2 n/a
7 TRCN0000183794 CCCTACACAATACTAACCTTT pLKO.1 4289 3UTR 100% 4.950 3.465 N PM20D2 n/a
8 TRCN0000183458 GAAATTAAAGGTGGAGCACAT pLKO.1 893 3UTR 100% 4.050 2.835 N PM20D2 n/a
9 TRCN0000149131 GTCTGTGTTCAGACAGCAAAT pLKO.1 846 3UTR 100% 1.080 0.756 N PM20D2 n/a
10 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 1884 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
11 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 2461 3UTR 100% 1.080 0.540 Y GPR83 n/a
12 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 2461 3UTR 100% 1.080 0.540 Y MYORG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001743167.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04900 pDONR223 100% 24.2% None 1_132del;889_890ins155;1286_4590del n/a
2 ccsbBroad304_04900 pLX_304 0% 24.2% V5 1_132del;889_890ins155;1286_4590del n/a
3 TRCN0000476441 CGAGTAACTTCAGACTCACCGTGC pLX_317 17.2% 24.2% V5 1_132del;889_890ins155;1286_4590del n/a
4 ccsbBroadEn_12783 pDONR223 100% 4% None (many diffs) n/a
5 ccsbBroad304_12783 pLX_304 0% 4% V5 (many diffs) n/a
6 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 4% V5 (many diffs) n/a
7 ccsbBroadEn_15487 pDONR223 0% 3.4% None (many diffs) n/a
8 ccsbBroad304_15487 pLX_304 0% 3.4% V5 (many diffs) n/a
9 TRCN0000473708 TAGCATCGTTGCACGCGCACGTTG pLX_317 100% 3.4% V5 (many diffs) n/a
Download CSV