Transcript: Human XR_001744751.2

PREDICTED: Homo sapiens tripartite motif containing 74 (TRIM74), transcript variant X25, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRIM74 (378108)
Length:
2176
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001744751.2
NBCI Gene record:
TRIM74 (378108)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001744751.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139360 CAGCTTCTGCTGTCCTTCTTT pLKO.1 777 3UTR 100% 5.625 2.813 Y STAG3L3 n/a
2 TRCN0000167398 GAATTTCTGTACTGGAAACTT pLKO.1 678 3UTR 100% 5.625 2.813 Y STAG3L2 n/a
3 TRCN0000062689 GCCGTCAGATTACTGATACTT pLKO.1 558 3UTR 100% 5.625 2.813 Y STAG3L1 n/a
4 TRCN0000135957 GCCGTCAGATTACTGATACTT pLKO.1 558 3UTR 100% 5.625 2.813 Y STAG3 n/a
5 TRCN0000142277 GCCGTCAGATTACTGATACTT pLKO.1 558 3UTR 100% 5.625 2.813 Y STAG3L3 n/a
6 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1819 3UTR 100% 4.950 2.475 Y CFLAR n/a
7 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1819 3UTR 100% 4.950 2.475 Y C19orf31 n/a
8 TRCN0000172776 GCTTCAAGGACTGGATGGTTT pLKO.1 499 3UTR 100% 4.950 2.475 Y STAG3L2 n/a
9 TRCN0000140844 CAGAGGACTTTCTTCCAGCTT pLKO.1 762 3UTR 100% 2.640 1.320 Y STAG3L3 n/a
10 TRCN0000142181 GTTTCCATGATCATGGACAGA pLKO.1 516 3UTR 100% 0.264 0.132 Y STAG3L3 n/a
11 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1817 3UTR 100% 4.950 2.475 Y ERN2 n/a
12 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1817 3UTR 100% 4.950 2.475 Y P3H4 n/a
13 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1817 3UTR 100% 4.950 2.475 Y P3H4 n/a
14 TRCN0000128227 CAGGAGAATCACTTGAATCTA pLKO.1 1987 3UTR 100% 5.625 2.813 Y NLRP8 n/a
15 TRCN0000107105 CGAGGTCAGGAGTTTGAGATT pLKO.1 1865 3UTR 100% 4.950 2.475 Y NLRP12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001744751.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10171 pDONR223 100% 12% None 1_363del;405_406ins124;642_2176del n/a
2 ccsbBroad304_10171 pLX_304 0% 12% V5 1_363del;405_406ins124;642_2176del n/a
3 TRCN0000474301 GGCATGATAACGCGACACGTACAC pLX_317 60.6% 12% V5 1_363del;405_406ins124;642_2176del n/a
4 ccsbBroadEn_13704 pDONR223 100% 10.9% None 1_401del;528A>G;642_2176del n/a
5 ccsbBroad304_13704 pLX_304 0% 10.9% V5 1_401del;528A>G;642_2176del n/a
6 ccsbBroadEn_10619 pDONR223 92.9% 9.1% None (many diffs) n/a
7 ccsbBroad304_10619 pLX_304 0% 9.1% V5 (many diffs) n/a
Download CSV