Transcript: Human XR_001746231.1

PREDICTED: Homo sapiens COBW domain containing 5 (CBWD5), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CBWD5 (220869)
Length:
4584
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001746231.1
NBCI Gene record:
CBWD5 (220869)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001746231.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242508 ACAACACTTCTGAACTATATT pLKO_005 269 3UTR 100% 15.000 7.500 Y CBWD1 n/a
2 TRCN0000242509 ACAATTATCACCGGGTATTTA pLKO_005 236 3UTR 100% 15.000 7.500 Y CBWD1 n/a
3 TRCN0000433358 AGCTGATTGCAGAGATATAAT pLKO_005 4485 3UTR 100% 15.000 7.500 Y CBWD2 n/a
4 TRCN0000426044 CAACACTTCTGAACTATATTT pLKO_005 270 3UTR 100% 15.000 7.500 Y CBWD2 n/a
5 TRCN0000242510 CTGAATTAGGGAGTGATATTT pLKO_005 564 3UTR 100% 15.000 7.500 Y CBWD1 n/a
6 TRCN0000242757 GGTCCTCATTGGCAGAAATTT pLKO_005 4042 3UTR 100% 15.000 7.500 Y CBWD5 n/a
7 TRCN0000242512 TAAGTTTCTACTGGGTATATT pLKO_005 4201 3UTR 100% 15.000 7.500 Y CBWD1 n/a
8 TRCN0000262472 ATAAGTTTCTACTGGGTATAT pLKO_005 4200 3UTR 100% 13.200 6.600 Y CBWD6 n/a
9 TRCN0000242760 ATCACTGCATGGAGGTCATAA pLKO_005 3894 3UTR 100% 13.200 6.600 Y CBWD5 n/a
10 TRCN0000262469 CACAATTATCACCGGGTATTT pLKO_005 235 3UTR 100% 13.200 6.600 Y CBWD6 n/a
11 TRCN0000130195 CCAAGATCCCAGTCACAATTA pLKO.1 222 3UTR 100% 13.200 6.600 Y CBWD2 n/a
12 TRCN0000130162 CCTCACCTTGATCAGAGTATT pLKO.1 3773 3UTR 100% 13.200 6.600 Y CBWD2 n/a
13 TRCN0000135757 CCTCACCTTGATCAGAGTATT pLKO.1 3773 3UTR 100% 13.200 6.600 Y CBWD3 n/a
14 TRCN0000242511 CTTGATGGTATCATAACTATT pLKO_005 587 3UTR 100% 13.200 6.600 Y CBWD1 n/a
15 TRCN0000134473 GATGACACTGAGAGAACAAAT pLKO.1 4016 3UTR 100% 13.200 6.600 Y CBWD3 n/a
16 TRCN0000167471 GCAAAGGAAGAACATCTTAAT pLKO.1 3824 3UTR 100% 13.200 6.600 Y CBWD1 n/a
17 TRCN0000242756 GAAATTGGCTTTGGAGTTTAC pLKO_005 4393 3UTR 100% 10.800 5.400 Y CBWD5 n/a
18 TRCN0000262471 TTGATGGTATCATAACTATTG pLKO_005 588 3UTR 100% 10.800 5.400 Y CBWD6 n/a
19 TRCN0000135436 GCAGTGGACAACACATTTCAA pLKO.1 4117 3UTR 100% 5.625 2.813 Y CBWD3 n/a
20 TRCN0000167645 GCTTTGGAGTTTACATATACT pLKO.1 4400 3UTR 100% 5.625 2.813 Y CBWD1 n/a
21 TRCN0000122476 CATCCTGGCTAACACTGTGAA pLKO.1 1240 3UTR 100% 4.950 2.475 Y AARD n/a
22 TRCN0000167241 CTACTGTGACAGAAACAGAAA pLKO.1 4095 3UTR 100% 4.950 2.475 Y CBWD1 n/a
23 TRCN0000135519 GATGCTGAATTAGGGAGTGAT pLKO.1 560 3UTR 100% 4.950 2.475 Y CBWD3 n/a
24 TRCN0000134746 GCCTTATCAATGAAGCTACTA pLKO.1 657 3UTR 100% 4.950 2.475 Y CBWD3 n/a
25 TRCN0000130465 GCTACTGTGACAGAAACAGAA pLKO.1 4094 3UTR 100% 4.950 2.475 Y CBWD2 n/a
26 TRCN0000136355 GCTACTGTGACAGAAACAGAA pLKO.1 4094 3UTR 100% 4.950 2.475 Y CBWD3 n/a
27 TRCN0000135615 GTCACAATTATCACCGGGTAT pLKO.1 233 3UTR 100% 4.050 2.025 Y CBWD3 n/a
28 TRCN0000128085 CTCTATGAAGAGTGGCTGGAA pLKO.1 389 3UTR 100% 2.640 1.320 Y CBWD2 n/a
29 TRCN0000135648 GAAGGGATTGGTGTCAATCAA pLKO.1 3919 3UTR 100% 0.563 0.281 Y CBWD3 n/a
30 TRCN0000136078 GTACCAGGAAATGCAAAGGAA pLKO.1 3812 3UTR 100% 0.000 0.000 Y CBWD3 n/a
31 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1177 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001746231.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10172 pDONR223 100% 25.7% None (many diffs) n/a
2 ccsbBroad304_10172 pLX_304 0% 25.7% V5 (many diffs) n/a
3 ccsbBroadEn_08604 pDONR223 100% 25.5% None (many diffs) n/a
4 ccsbBroad304_08604 pLX_304 0% 25.5% V5 (many diffs) n/a
5 ccsbBroadEn_03674 pDONR223 100% 25.5% None (many diffs) n/a
6 ccsbBroad304_03674 pLX_304 0% 25.5% V5 (many diffs) n/a
7 TRCN0000492257 CAGAGTAATCATATCCCTTTGTTC pLX_317 36.1% 25.5% V5 (many diffs) n/a
8 ccsbBroadEn_15265 pDONR223 73.3% 25.5% None (many diffs) n/a
9 ccsbBroad304_15265 pLX_304 0% 25.5% V5 (many diffs) n/a
10 ccsbBroadEn_09670 pDONR223 100% 25.5% None (many diffs) n/a
11 TRCN0000473698 TTACTTGTTCAATCGAACGCGGTT pLX_317 42.3% 25.5% V5 (many diffs) n/a
12 ccsbBroadEn_08603 pDONR223 100% 22.8% None (many diffs) n/a
13 ccsbBroad304_08603 pLX_304 0% 22.8% V5 (many diffs) n/a
14 TRCN0000491579 GTTCACCCGAGATAGGATGAAGAC pLX_317 32.7% 22.8% V5 (many diffs) n/a
15 ccsbBroadEn_13415 pDONR223 100% 11.7% None (many diffs) n/a
16 ccsbBroad304_13415 pLX_304 0% 11.7% V5 (many diffs) n/a
17 TRCN0000480607 CTTTTTTTTCAGTAGCCCCGCCGA pLX_317 73.5% 11.7% V5 (many diffs) n/a
Download CSV