Transcript: Human XR_001751398.2

PREDICTED: Homo sapiens WD repeat domain 76 (WDR76), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WDR76 (79968)
Length:
3829
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001751398.2
NBCI Gene record:
WDR76 (79968)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001751398.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243003 TGCACCCAACTCGGTATATTT pLKO_005 1842 3UTR 100% 15.000 21.000 N WDR76 n/a
2 TRCN0000243000 CTGTCTAAGGAGCCTAGTAAT pLKO_005 1961 3UTR 100% 13.200 18.480 N WDR76 n/a
3 TRCN0000168714 GCATTCGTTTGGTGGAGAATA pLKO.1 1792 3UTR 100% 13.200 18.480 N WDR76 n/a
4 TRCN0000243001 AGACAACAATGAACGATTTAA pLKO_005 820 3UTR 100% 15.000 10.500 N WDR76 n/a
5 TRCN0000243004 AGTTACCACAGGCCCAATATT pLKO_005 970 3UTR 100% 15.000 10.500 N WDR76 n/a
6 TRCN0000243002 GATTGAGGGATACTCATATTT pLKO_005 1443 3UTR 100% 15.000 10.500 N WDR76 n/a
7 TRCN0000167159 CCTTAGTGTGTTTATGTGGTA pLKO.1 1989 3UTR 100% 2.640 1.848 N WDR76 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001751398.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08995 pDONR223 100% 49% None 1_40del;497T>G;1919_3829del n/a
2 ccsbBroad304_08995 pLX_304 0% 49% V5 1_40del;497T>G;1919_3829del n/a
3 TRCN0000465817 ACGCGACGGGTCAACGCCGTATCC pLX_317 22.4% 49% V5 1_40del;497T>G;1919_3829del n/a
4 ccsbBroadEn_04156 pDONR223 100% 44% None 1_232del;1919_3829del n/a
5 ccsbBroad304_04156 pLX_304 0% 44% V5 1_232del;1919_3829del n/a
6 TRCN0000479593 AAACCAGCTGTTTCAAATCCATGC pLX_317 20.5% 44% V5 1_232del;1919_3829del n/a
7 ccsbBroadEn_12783 pDONR223 100% 4.9% None (many diffs) n/a
8 ccsbBroad304_12783 pLX_304 0% 4.9% V5 (many diffs) n/a
9 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 4.9% V5 (many diffs) n/a
10 ccsbBroadEn_10261 pDONR223 100% 1.6% None (many diffs) n/a
11 ccsbBroad304_10261 pLX_304 0% 1.6% V5 (many diffs) n/a
12 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% 1.6% V5 (many diffs) n/a
Download CSV