Transcript: Human XR_002956407.1

PREDICTED: Homo sapiens BUD23 rRNA methyltransferase and ribosome maturation factor (BUD23), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BUD23 (114049)
Length:
4906
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002956407.1
NBCI Gene record:
BUD23 (114049)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002956407.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275216 CCTGTTACCTGCTGGATATTG pLKO_005 216 3UTR 100% 13.200 18.480 N BUD23 n/a
2 TRCN0000139958 GTTCGCAACTCACGGATGATT pLKO.1 134 3UTR 100% 5.625 7.875 N BUD23 n/a
3 TRCN0000275177 GTTCGCAACTCACGGATGATT pLKO_005 134 3UTR 100% 5.625 7.875 N BUD23 n/a
4 TRCN0000140056 CGGAAATACGTTCGCAACTCA pLKO.1 125 3UTR 100% 3.000 4.200 N BUD23 n/a
5 TRCN0000140262 GCCAGAGAATAAGCCCTGTTA pLKO.1 202 3UTR 100% 4.950 3.960 N BUD23 n/a
6 TRCN0000275215 TCAGCTGACAAAGTAGTATTT pLKO_005 4829 3UTR 100% 13.200 9.240 N BUD23 n/a
7 TRCN0000140572 GACTACCCTAACAGTGCCAAA pLKO.1 623 3UTR 100% 4.050 2.835 N BUD23 n/a
8 TRCN0000275217 GACTACCCTAACAGTGCCAAA pLKO_005 623 3UTR 100% 4.050 2.835 N BUD23 n/a
9 TRCN0000142391 GATTGATATCCAGACCAGGAT pLKO.1 151 3UTR 100% 2.640 1.848 N BUD23 n/a
10 TRCN0000144133 CAGTGCCAAAGCAAAGAAATT pLKO.1 634 3UTR 100% 13.200 7.920 N BUD23 n/a
11 TRCN0000275218 CAGTGCCAAAGCAAAGAAATT pLKO_005 634 3UTR 100% 13.200 7.920 N BUD23 n/a
12 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 2463 3UTR 100% 4.950 2.475 Y n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2534 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000116227 CCTCCCAAAGTTCTGGGATTA pLKO.1 2234 3UTR 100% 1.080 0.540 Y ELOVL7 n/a
15 TRCN0000164591 CCTCCCAAAGTTCTGGGATTA pLKO.1 2234 3UTR 100% 1.080 0.540 Y TNNI1 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2534 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002956407.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09392 pDONR223 100% 16.1% None (many diffs) n/a
2 ccsbBroad304_09392 pLX_304 0% 16.1% V5 (many diffs) n/a
3 TRCN0000476664 AGAGCCGGGTCTCATCACCTAGGA pLX_317 47.1% 16.1% V5 (many diffs) n/a
4 ccsbBroadEn_14355 pDONR223 100% 14.2% None (many diffs) n/a
5 ccsbBroad304_14355 pLX_304 0% 14.2% V5 (not translated due to frame shift) (many diffs) n/a
6 TRCN0000469948 TGCATAAGCTCCCATATTTGTTTA pLX_317 64.3% 14.2% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_12783 pDONR223 100% 3.7% None (many diffs) n/a
8 ccsbBroad304_12783 pLX_304 0% 3.7% V5 (many diffs) n/a
9 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 3.7% V5 (many diffs) n/a
Download CSV