Transcript: Human XR_002956485.1

PREDICTED: Homo sapiens zinc finger with KRAB and SCAN domains 1 (ZKSCAN1), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZKSCAN1 (7586)
Length:
10439
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002956485.1
NBCI Gene record:
ZKSCAN1 (7586)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002956485.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018135 CAACCGAAACTCATACCTGAT pLKO.1 2749 3UTR 100% 4.050 5.670 N ZKSCAN1 n/a
2 TRCN0000018136 CTGCACTATTCACAGCGGATT pLKO.1 881 3UTR 100% 4.050 5.670 N ZKSCAN1 n/a
3 TRCN0000241415 TCAAGCCTTATCCGCCATAAA pLKO_005 2423 3UTR 100% 13.200 9.240 N Zkscan1 n/a
4 TRCN0000018133 CGGGAACAAAGTCTCACAGAT pLKO.1 2370 3UTR 100% 4.950 3.465 N ZKSCAN1 n/a
5 TRCN0000018134 CCAGAAATAAACACCAAGGAA pLKO.1 493 3UTR 100% 3.000 2.100 N ZKSCAN1 n/a
6 TRCN0000018137 CGCTTCTGTTACCAGAACACT pLKO.1 415 3UTR 100% 0.300 0.210 N ZKSCAN1 n/a
7 TRCN0000256745 CAGCCTGGCCAACATGGTAAA pLKO_005 5271 3UTR 100% 10.800 5.400 Y SMIM11A n/a
8 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 2622 3UTR 100% 5.625 2.813 Y ZNF345 n/a
9 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 5204 3UTR 100% 4.950 2.475 Y ERAP2 n/a
10 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 7838 3UTR 100% 4.050 2.025 Y P3H4 n/a
11 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 7838 3UTR 100% 4.050 2.025 Y ORAI2 n/a
12 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 7838 3UTR 100% 4.050 2.025 Y P3H4 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5205 3UTR 100% 13.200 6.600 Y LIAS n/a
14 TRCN0000143232 GAAGAGGAAGATGAGGAAGAA pLKO.1 319 3UTR 100% 4.950 2.475 Y ARMH4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002956485.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01799 pDONR223 100% 16.1% None (many diffs) n/a
2 ccsbBroad304_01799 pLX_304 0% 16.1% V5 (many diffs) n/a
3 TRCN0000468174 GGCTGATACACAGACCGACTATGA pLX_317 20.7% 16.1% V5 (many diffs) n/a
4 ccsbBroadEn_15622 pDONR223 0% 16.1% None (many diffs) n/a
5 ccsbBroad304_15622 pLX_304 0% 16.1% V5 (many diffs) n/a
6 TRCN0000467809 CCACCCTGTTAGCTGCGGCCAGAG pLX_317 23.6% 16.1% V5 (many diffs) n/a
Download CSV