Transcript: Human XR_002958390.1

PREDICTED: Homo sapiens putative zinc finger protein 137 (LOC107987264), misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC107987264 (107987264)
Length:
925
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002958390.1
NBCI Gene record:
LOC107987264 (107987264)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002958390.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149130 GCTGGAGAGAAACCTTACAAA pLKO.1 358 3UTR 100% 5.625 2.813 Y ZNF761 n/a
2 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 779 3UTR 100% 4.950 2.475 Y ERAP2 n/a
3 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 818 3UTR 100% 4.050 2.025 Y P3H4 n/a
4 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 818 3UTR 100% 4.050 2.025 Y ORAI2 n/a
5 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 818 3UTR 100% 4.050 2.025 Y P3H4 n/a
6 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 780 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002958390.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10493 pDONR223 100% 52% None (many diffs) n/a
2 ccsbBroad304_10493 pLX_304 0% 52% V5 (many diffs) n/a
3 TRCN0000473858 GACTCTAACGAATGTATACCTGAC pLX_317 78.5% 52% V5 (many diffs) n/a
4 ccsbBroadEn_12729 pDONR223 100% 43.4% None (many diffs) n/a
5 ccsbBroad304_12729 pLX_304 0% 43.4% V5 (many diffs) n/a
6 TRCN0000465897 CCCGCAATCACAACGATCTCAAAA pLX_317 70.4% 43.4% V5 (many diffs) n/a
7 ccsbBroadEn_13646 pDONR223 100% 22.1% None (many diffs) n/a
8 ccsbBroad304_13646 pLX_304 0% 22.1% V5 (many diffs) n/a
9 TRCN0000473343 CGTTTTTTTACCTCATATCTGGTT pLX_317 100% 22.1% V5 (many diffs) n/a
Download CSV