Transcript: Human XR_242255.5

PREDICTED: Homo sapiens NOP2/Sun RNA methyltransferase 5 (NSUN5), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NSUN5 (55695)
Length:
1626
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_242255.5
NBCI Gene record:
NSUN5 (55695)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_242255.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141287 CAAGGTGCTAGTGTATGAGTT pLKO.1 249 3UTR 100% 4.950 3.465 N NSUN5 n/a
2 TRCN0000140865 CCAAGGTGCTAGTGTATGAGT pLKO.1 248 3UTR 100% 3.000 1.800 N NSUN5 n/a
3 TRCN0000160860 GAGAAAGAAGAGACAGCAAAG pLKO.1 1376 3UTR 100% 6.000 3.000 Y NSUN5P1 n/a
4 TRCN0000160335 CTTCTTCGTTGCTGTAATTGA pLKO.1 1280 3UTR 100% 5.625 2.813 Y NSUN5P1 n/a
5 TRCN0000139008 CCAGACAGATCTGCATGAACA pLKO.1 615 3UTR 100% 4.950 2.475 Y NSUN5P2 n/a
6 TRCN0000139160 CTTGGCTGCTCTTCTGAAGAA pLKO.1 765 3UTR 100% 4.950 2.475 Y NSUN5P2 n/a
7 TRCN0000422003 GCCTCGATTTGTGCGTGTGAA pLKO_005 438 3UTR 100% 4.950 2.475 Y NSUN5 n/a
8 TRCN0000139890 GCTGCTCTTCTGAAGAACCAA pLKO.1 769 3UTR 100% 3.000 1.500 Y NSUN5P2 n/a
9 TRCN0000142689 CAAGAGACAAGGTTTCTCCTA pLKO.1 498 3UTR 100% 2.640 1.320 Y NSUN5 n/a
10 TRCN0000139265 CAGGCAATAAGACCAGTCACT pLKO.1 746 3UTR 100% 2.640 1.320 Y NSUN5 n/a
11 TRCN0000140119 GTTGCTGTAATTGAACGGGTC pLKO.1 1287 3UTR 100% 1.200 0.600 Y NSUN5P2 n/a
12 TRCN0000139787 CGTTGCTGTAATTGAACGGGT pLKO.1 1286 3UTR 100% 0.660 0.330 Y NSUN5P2 n/a
13 TRCN0000413641 AGAACGTACTCTACGATAGAT pLKO_005 1607 3UTR 100% 5.625 3.375 N NSUN5 n/a
14 TRCN0000097511 GCCAAGGTGCTAGTGTATGAA pLKO.1 247 3UTR 100% 5.625 3.375 N Nsun5 n/a
15 TRCN0000311953 GCCAAGGTGCTAGTGTATGAA pLKO_005 247 3UTR 100% 5.625 3.375 N Nsun5 n/a
16 TRCN0000139053 CCAGGAGGAGAATGAAGACAT pLKO.1 1118 3UTR 100% 4.950 2.475 Y NSUN5P2 n/a
17 TRCN0000163612 CCAGGAGGAGAATGAAGACAT pLKO.1 1118 3UTR 100% 4.950 2.475 Y NSUN5P1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_242255.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08566 pDONR223 100% 85.5% None 1_36del;790_791insGGAA;1431_1626del n/a
2 ccsbBroad304_08566 pLX_304 0% 85.5% V5 1_36del;790_791insGGAA;1431_1626del n/a
3 TRCN0000470621 AGCCCCTATTGAGCGATGCATTTT pLX_317 23.1% 85.5% V5 1_36del;790_791insGGAA;1431_1626del n/a
4 ccsbBroadEn_10586 pDONR223 100% 55.3% None (many diffs) n/a
5 ccsbBroad304_10586 pLX_304 0% 55.3% V5 (many diffs) n/a
6 TRCN0000476107 ACACTAGTTGTGTTTCCCCCATAA pLX_317 38% 55.3% V5 (many diffs) n/a
7 ccsbBroadEn_16140 pDONR223 0% 34.8% None (many diffs) n/a
8 ccsbBroad304_16140 pLX_304 0% 34.8% V5 (many diffs) n/a
9 TRCN0000492153 CATGACTGTAGCGGTGCCCGGACT pLX_317 68.5% 34.8% V5 (many diffs) n/a
10 ccsbBroadEn_10568 pDONR223 100% 28.3% None (many diffs) n/a
11 ccsbBroad304_10568 pLX_304 0% 28.3% V5 (many diffs) n/a
12 TRCN0000467263 GAAGACACTCTCCAACTGCCGTTC pLX_317 78.7% 28.3% V5 (many diffs) n/a
13 ccsbBroadEn_16141 pDONR223 0% 20.5% None (many diffs) n/a
14 ccsbBroad304_16141 pLX_304 0% 20.5% V5 (many diffs) n/a
15 TRCN0000478632 CGGTACCAACAGGCCTAATCACGC pLX_317 100% 20.5% V5 (many diffs) n/a
16 ccsbBroadEn_14410 pDONR223 100% 20.5% None (many diffs) n/a
17 ccsbBroad304_14410 pLX_304 0% 20.5% V5 (many diffs) n/a
18 TRCN0000481138 ATGCGATGACCGCCACCACATATC pLX_317 80.2% 20.5% V5 (many diffs) n/a
Download CSV