Transcript: Human XR_946659.3

PREDICTED: Homo sapiens nescient helix-loop-helix 2 (NHLH2), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NHLH2 (4808)
Length:
4869
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_946659.3
NBCI Gene record:
NHLH2 (4808)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_946659.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015054 CTGCTACATCTCCTATCTCAA pLKO.1 885 3UTR 100% 4.950 6.930 N NHLH2 n/a
2 TRCN0000424496 CTGCTACATCTCCTATCTCAA pLKO_005 885 3UTR 100% 4.950 6.930 N Nhlh2 n/a
3 TRCN0000015056 CCGCAAATTGCTGCCCACGCT pLKO.1 816 3UTR 100% 0.000 0.000 N NHLH2 n/a
4 TRCN0000015055 CGGCACGGACACCAAGGTGCT pLKO.1 591 3UTR 100% 0.000 0.000 N NHLH2 n/a
5 TRCN0000015057 GCCATCTGCTACATCTCCTAT pLKO.1 880 3UTR 100% 4.950 2.970 N NHLH2 n/a
6 TRCN0000140759 GCCTTTCAAAGTGCTGGGATT pLKO.1 3963 3UTR 100% 4.050 2.025 Y INAVA n/a
7 TRCN0000155070 GCCTTTCAAAGTGCTGGGATT pLKO.1 3963 3UTR 100% 4.050 2.025 Y ASB6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_946659.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01097 pDONR223 100% 8.3% None 1_516del;922_4869del n/a
2 ccsbBroad304_01097 pLX_304 0% 8.3% V5 1_516del;922_4869del n/a
3 TRCN0000476702 TCCATCAACGTTTCGGACATTGGT pLX_317 98.1% 8.3% V5 1_516del;922_4869del n/a
4 ccsbBroadEn_15487 pDONR223 0% 3.3% None (many diffs) n/a
5 ccsbBroad304_15487 pLX_304 0% 3.3% V5 (many diffs) n/a
6 TRCN0000473708 TAGCATCGTTGCACGCGCACGTTG pLX_317 100% 3.3% V5 (many diffs) n/a
7 ccsbBroadEn_10261 pDONR223 100% 1.2% None (many diffs) n/a
8 ccsbBroad304_10261 pLX_304 0% 1.2% V5 (many diffs) n/a
9 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% 1.2% V5 (many diffs) n/a
Download CSV