Vector: pLKO_TRC005

View complete vector list

Note: Vector maps may be generated using Vector NTI, which is no longer free, or with the free and easy-to-use plasmid editor ApE.

Vector Information:

Vector Name:
pLKO_TRC005
Alias:
pLKO.5
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
1.9 KB Stuffer
Selection Marker:
PuroR
Visible Reporter:
n/a
Cloning Site:
1.9 KB Stuffer
Sequence Data:
GB, FASTA

Control Clones

Clone ID Target Seq Target Gene ID Target Gene Symbol Taxon Target Region Notes
1 TRCN0000231761 CGACGTAAACGGCCACAAGTT GFP GFP CONTROL CDS N/A
2 TRCN0000231764 CTCTCGGCATGGACGAGCTGT GFP GFP CONTROL CDS N/A
3 TRCN0000231745 TGACCCTGAAGTTCATCTGCA GFP GFP CONTROL CDS N/A
4 TRCN0000231765 CCTACGGCGTGCAGTGCTTCA GFP GFP CONTROL CDS N/A
5 TRCN0000231749 CGACCACATGAAGCAGCACGA GFP GFP CONTROL CDS N/A
6 TRCN0000231759 GACCACATGAAGCAGCACGAC GFP GFP CONTROL CDS N/A
7 TRCN0000231762 CCACATGAAGCAGCACGACTT GFP GFP CONTROL CDS N/A
8 TRCN0000231744 AGTACAACTACAACAGCCACA GFP GFP CONTROL CDS N/A
9 TRCN0000231747 TACAACAGCCACAACGTCTAT GFP GFP CONTROL CDS N/A
10 TRCN0000231753 ACAACAGCCACAACGTCTATA GFP GFP CONTROL CDS N/A
11 TRCN0000231756 ACGTCTATATCATGGCCGACA GFP GFP CONTROL CDS N/A
12 TRCN0000231754 CTATATCATGGCCGACAAGCA GFP GFP CONTROL CDS N/A
13 TRCN0000231760 GAACGGCATCAAGGTGAACTT GFP GFP CONTROL CDS N/A
14 TRCN0000231705 GCCACAACATCGAGGACGGCA GFP GFP CONTROL CDS N/A
15 TRCN0000231752 TCTCGGCATGGACGAGCTGTA GFP GFP CONTROL CDS N/A
16 TRCN0000231751 CGGCATGGACGAGCTGTACAA GFP GFP CONTROL CDS N/A
17 TRCN0000231763 CCCGACCACATGAAGCAGCAC GFP GFP CONTROL CDS N/A
18 TRCN0000231750 CAACAGCCACAACGTCTATAT GFP GFP CONTROL CDS N/A
19 TRCN0000231755 GCGACGTAAACGGCCACAAGT GFP GFP CONTROL CDS N/A
20 TRCN0000231746 TGCCCGACAACCACTACCTGA GFP GFP CONTROL CDS N/A
21 TRCN0000231758 GCGCGATCACATGGTCCTGCT GFP GFP CONTROL CDS N/A
22 TRCN0000231748 CGGGATCACTCTCGGCATGGA GFP GFP CONTROL CDS N/A
23 TRCN0000231757 CTACGGCAAGCTGACCCTGAA GFP GFP CONTROL CDS N/A
24 TRCN0000231736 CACTTACGCTGAGTACTTCGA LUCIFERASE LUCIFERASE CONTROL CDS N/A
25 TRCN0000231733 ACTTACGCTGAGTACTTCGAA LUCIFERASE LUCIFERASE CONTROL CDS N/A
26 TRCN0000231742 ACGCTGAGTACTTCGAAATGT LUCIFERASE LUCIFERASE CONTROL CDS N/A
27 TRCN0000231741 GCTGAGTACTTCGAAATGTCC LUCIFERASE LUCIFERASE CONTROL CDS N/A
28 TRCN0000231740 TGAGTACTTCGAAATGTCCGT LUCIFERASE LUCIFERASE CONTROL CDS N/A
29 TRCN0000231728 GAGTACTTCGAAATGTCCGTT LUCIFERASE LUCIFERASE CONTROL CDS N/A
30 TRCN0000231693 CTTCGAAATGTCCGTTCGGTT LUCIFERASE LUCIFERASE CONTROL CDS N/A
31 TRCN0000231699 CAAATCACAGAATCGTCGTAT LUCIFERASE LUCIFERASE CONTROL CDS N/A
32 TRCN0000231695 ATCACAGAATCGTCGTATGCA LUCIFERASE LUCIFERASE CONTROL CDS N/A
33 TRCN0000231697 TCACAGAATCGTCGTATGCAG LUCIFERASE LUCIFERASE CONTROL CDS N/A
34 TRCN0000231730 AGAATCGTCGTATGCAGTGAA LUCIFERASE LUCIFERASE CONTROL CDS N/A
35 TRCN0000231720 GAATCGTCGTATGCAGTGAAA LUCIFERASE LUCIFERASE CONTROL CDS N/A
36 TRCN0000231734 TCTACTGGTCTGCCTAAAGGT LUCIFERASE LUCIFERASE CONTROL CDS N/A
37 TRCN0000231737 ATGTTTACTACACTCGGATAT LUCIFERASE LUCIFERASE CONTROL CDS N/A
38 TRCN0000231732 ACACTCGGATATTTGATATGT LUCIFERASE LUCIFERASE CONTROL CDS N/A
39 TRCN0000231707 CACTCGGATATTTGATATGTG LUCIFERASE LUCIFERASE CONTROL CDS N/A
40 TRCN0000231719 GCGGTTGCCAAGAGGTTCCAT LUCIFERASE LUCIFERASE CONTROL CDS N/A
41 TRCN0000231721 TGTCCGGTTATGTAAACAATC LUCIFERASE LUCIFERASE CONTROL CDS N/A
42 TRCN0000231718 AGTCAAGTAACAACCGCGAAA LUCIFERASE LUCIFERASE CONTROL CDS N/A
43 TRCN0000231727 GTTGTGTTTGTGGACGAAGTA LUCIFERASE LUCIFERASE CONTROL CDS N/A
44 TRCN0000231731 GCGCCATTCTATCCGCTGGAA LUCIFERASE LUCIFERASE CONTROL CDS N/A
45 TRCN0000231715 CGCTGAGTACTTCGAAATGTC LUCIFERASE LUCIFERASE CONTROL CDS N/A
46 TRCN0000231739 AGTACTTCGAAATGTCCGTTC LUCIFERASE LUCIFERASE CONTROL CDS N/A
47 TRCN0000231729 GAATGTTTACTACACTCGGAT LUCIFERASE LUCIFERASE CONTROL CDS N/A
48 TRCN0000231714 CAGAATCGTCGTATGCAGTGA LUCIFERASE LUCIFERASE CONTROL CDS N/A
49 TRCN0000231723 CTACACCATCGTGGAACAGTA RFP RFP CONTROL CDS N/A
50 TRCN0000231725 ACTACACCATCGTGGAACAGT RFP RFP CONTROL CDS N/A
51 TRCN0000231692 CAACGAGGACTACACCATCGT RFP RFP CONTROL CDS N/A
52 TRCN0000231689 CTACAAGACCGACATCAAGCT RFP RFP CONTROL CDS N/A
53 TRCN0000231687 TGCAGAAGAAGACCATGGGCT RFP RFP CONTROL CDS N/A
54 TRCN0000231696 GTAATGCAGAAGAAGACCATG RFP RFP CONTROL CDS N/A
55 TRCN0000231690 CGTAATGCAGAAGAAGACCAT RFP RFP CONTROL CDS N/A
56 TRCN0000231724 CCGTAATGCAGAAGAAGACCA RFP RFP CONTROL CDS N/A
57 TRCN0000231688 CCTGCAGGACGGCGAGTTCAT RFP RFP CONTROL CDS N/A
58 TRCN0000231682 GCTTCAAGTGGGAGCGCGTGA RFP RFP CONTROL CDS N/A
59 TRCN0000231684 GTACGGCTCCAAGGCCTACGT RFP RFP CONTROL CDS N/A
60 TRCN0000231686 CAGTTCCAGTACGGCTCCAAG RFP RFP CONTROL CDS N/A
61 TRCN0000231683 CTCAGTTCCAGTACGGCTCCA RFP RFP CONTROL CDS N/A
62 TRCN0000231698 CGAGTTCGAGATCGAGGGCGA RFP RFP CONTROL CDS N/A
63 TRCN0000231691 GAACGGCCACGAGTTCGAGAT RFP RFP CONTROL CDS N/A
64 TRCN0000231703 GCTCCGTGAACGGCCACGAGT RFP RFP CONTROL CDS N/A
65 TRCN0000231694 CCACTACGACGCCGAGGTCAA RFP RFP CONTROL CDS N/A
66 TRCN0000231701 TCAGTTCCAGTACGGCTCCAA RFP RFP CONTROL CDS N/A
67 TRCN0000231711 CCCGTCAGTATCGGCGGAATT lacZ lacZ CONTROL CDS N/A
68 TRCN0000231704 GCGTTGGCAATTTAACCGCCA lacZ lacZ CONTROL CDS N/A
69 TRCN0000231713 ACTCTGGCTAACGGTACGCGT lacZ lacZ CONTROL CDS N/A
70 TRCN0000231738 CCGTCATAGCGATAACGAGTT lacZ lacZ CONTROL CDS N/A
71 TRCN0000231685 GTTCCGTCATAGCGATAACGA lacZ lacZ CONTROL CDS N/A
72 TRCN0000231706 GTCGGCTTACGGCGGTGATTT lacZ lacZ CONTROL CDS N/A
73 TRCN0000231710 CGCTAAATACTGGCAGGCGTT lacZ lacZ CONTROL CDS N/A
74 TRCN0000231708 GCGCTAATCACGACGCGCTGT lacZ lacZ CONTROL CDS N/A
75 TRCN0000231709 CGATCGTAATCACCCGAGTGT lacZ lacZ CONTROL CDS N/A
76 TRCN0000231712 GCGATCGTAATCACCCGAGTG lacZ lacZ CONTROL CDS N/A
77 TRCN0000231722 CGCGATCGTAATCACCCGAGT lacZ lacZ CONTROL CDS N/A
78 TRCN0000231726 TGTTCGCATTATCCGAACCAT lacZ lacZ CONTROL CDS N/A
79 TRCN0000231743 CGCGCCTTTCGGCGGTGAAAT lacZ lacZ CONTROL CDS N/A
80 TRCN0000231716 CGACCACGCAAATCAGCGATT lacZ lacZ CONTROL CDS N/A
81 TRCN0000231735 CCAACGTGACCTATCCCATTA lacZ lacZ CONTROL CDS N/A
82 TRCN0000231702 TCGTATTACAACGTCGTGACT lacZ lacZ CONTROL CDS N/A
83 TRCN0000231717 CGTCGTATTACAACGTCGTGA lacZ lacZ CONTROL CDS N/A
84 TRCN0000231700 GCCGTCGTATTACAACGTCGT lacZ lacZ CONTROL CDS N/A
85 TRCN0000241923 (no hairpin) N/A N/A N/A N/A
Download CSV