Vector: pLKO_TRC005

View complete vector list

Note: Vector maps may be generated using Vector NTI, which is no longer free, or with the free and easy-to-use plasmid editor ApE.

Vector Information:

Vector Name:
pLKO_TRC005
Alias:
pLKO.5
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
1.9 KB Stuffer
Selection Marker:
PuroR
Visible Reporter:
n/a
Cloning Site:
1.9 KB Stuffer
Sequence Data:
GB, FASTA

Control Clones

Clone ID Target Seq Target Gene ID Target Gene Symbol Taxon Target Region Notes
1 TRCN0000231758 GCGCGATCACATGGTCCTGCT GFP GFP CONTROL CDS
2 TRCN0000231762 CCACATGAAGCAGCACGACTT GFP GFP CONTROL CDS
3 TRCN0000231764 CTCTCGGCATGGACGAGCTGT GFP GFP CONTROL CDS
4 TRCN0000231752 TCTCGGCATGGACGAGCTGTA GFP GFP CONTROL CDS
5 TRCN0000231751 CGGCATGGACGAGCTGTACAA GFP GFP CONTROL CDS
6 TRCN0000231763 CCCGACCACATGAAGCAGCAC GFP GFP CONTROL CDS
7 TRCN0000231750 CAACAGCCACAACGTCTATAT GFP GFP CONTROL CDS
8 TRCN0000231744 AGTACAACTACAACAGCCACA GFP GFP CONTROL CDS
9 TRCN0000231747 TACAACAGCCACAACGTCTAT GFP GFP CONTROL CDS
10 TRCN0000231753 ACAACAGCCACAACGTCTATA GFP GFP CONTROL CDS
11 TRCN0000231756 ACGTCTATATCATGGCCGACA GFP GFP CONTROL CDS
12 TRCN0000231754 CTATATCATGGCCGACAAGCA GFP GFP CONTROL CDS
13 TRCN0000231760 GAACGGCATCAAGGTGAACTT GFP GFP CONTROL CDS
14 TRCN0000231705 GCCACAACATCGAGGACGGCA GFP GFP CONTROL CDS
15 TRCN0000231746 TGCCCGACAACCACTACCTGA GFP GFP CONTROL CDS
16 TRCN0000231755 GCGACGTAAACGGCCACAAGT GFP GFP CONTROL CDS
17 TRCN0000231761 CGACGTAAACGGCCACAAGTT GFP GFP CONTROL CDS
18 TRCN0000231757 CTACGGCAAGCTGACCCTGAA GFP GFP CONTROL CDS
19 TRCN0000231745 TGACCCTGAAGTTCATCTGCA GFP GFP CONTROL CDS
20 TRCN0000231765 CCTACGGCGTGCAGTGCTTCA GFP GFP CONTROL CDS
21 TRCN0000231749 CGACCACATGAAGCAGCACGA GFP GFP CONTROL CDS
22 TRCN0000231759 GACCACATGAAGCAGCACGAC GFP GFP CONTROL CDS
23 TRCN0000231748 CGGGATCACTCTCGGCATGGA GFP GFP CONTROL CDS
24 TRCN0000231697 TCACAGAATCGTCGTATGCAG LUCIFERASE LUCIFERASE CONTROL CDS
25 TRCN0000231730 AGAATCGTCGTATGCAGTGAA LUCIFERASE LUCIFERASE CONTROL CDS
26 TRCN0000231720 GAATCGTCGTATGCAGTGAAA LUCIFERASE LUCIFERASE CONTROL CDS
27 TRCN0000231734 TCTACTGGTCTGCCTAAAGGT LUCIFERASE LUCIFERASE CONTROL CDS
28 TRCN0000231737 ATGTTTACTACACTCGGATAT LUCIFERASE LUCIFERASE CONTROL CDS
29 TRCN0000231732 ACACTCGGATATTTGATATGT LUCIFERASE LUCIFERASE CONTROL CDS
30 TRCN0000231707 CACTCGGATATTTGATATGTG LUCIFERASE LUCIFERASE CONTROL CDS
31 TRCN0000231719 GCGGTTGCCAAGAGGTTCCAT LUCIFERASE LUCIFERASE CONTROL CDS
32 TRCN0000231721 TGTCCGGTTATGTAAACAATC LUCIFERASE LUCIFERASE CONTROL CDS
33 TRCN0000231718 AGTCAAGTAACAACCGCGAAA LUCIFERASE LUCIFERASE CONTROL CDS
34 TRCN0000231727 GTTGTGTTTGTGGACGAAGTA LUCIFERASE LUCIFERASE CONTROL CDS
35 TRCN0000231731 GCGCCATTCTATCCGCTGGAA LUCIFERASE LUCIFERASE CONTROL CDS
36 TRCN0000231715 CGCTGAGTACTTCGAAATGTC LUCIFERASE LUCIFERASE CONTROL CDS
37 TRCN0000231739 AGTACTTCGAAATGTCCGTTC LUCIFERASE LUCIFERASE CONTROL CDS
38 TRCN0000231714 CAGAATCGTCGTATGCAGTGA LUCIFERASE LUCIFERASE CONTROL CDS
39 TRCN0000231729 GAATGTTTACTACACTCGGAT LUCIFERASE LUCIFERASE CONTROL CDS
40 TRCN0000231736 CACTTACGCTGAGTACTTCGA LUCIFERASE LUCIFERASE CONTROL CDS
41 TRCN0000231733 ACTTACGCTGAGTACTTCGAA LUCIFERASE LUCIFERASE CONTROL CDS
42 TRCN0000231742 ACGCTGAGTACTTCGAAATGT LUCIFERASE LUCIFERASE CONTROL CDS
43 TRCN0000231741 GCTGAGTACTTCGAAATGTCC LUCIFERASE LUCIFERASE CONTROL CDS
44 TRCN0000231740 TGAGTACTTCGAAATGTCCGT LUCIFERASE LUCIFERASE CONTROL CDS
45 TRCN0000231728 GAGTACTTCGAAATGTCCGTT LUCIFERASE LUCIFERASE CONTROL CDS
46 TRCN0000231693 CTTCGAAATGTCCGTTCGGTT LUCIFERASE LUCIFERASE CONTROL CDS
47 TRCN0000231699 CAAATCACAGAATCGTCGTAT LUCIFERASE LUCIFERASE CONTROL CDS
48 TRCN0000231695 ATCACAGAATCGTCGTATGCA LUCIFERASE LUCIFERASE CONTROL CDS
49 TRCN0000231703 GCTCCGTGAACGGCCACGAGT RFP RFP CONTROL CDS
50 TRCN0000231694 CCACTACGACGCCGAGGTCAA RFP RFP CONTROL CDS
51 TRCN0000231698 CGAGTTCGAGATCGAGGGCGA RFP RFP CONTROL CDS
52 TRCN0000231683 CTCAGTTCCAGTACGGCTCCA RFP RFP CONTROL CDS
53 TRCN0000231686 CAGTTCCAGTACGGCTCCAAG RFP RFP CONTROL CDS
54 TRCN0000231684 GTACGGCTCCAAGGCCTACGT RFP RFP CONTROL CDS
55 TRCN0000231682 GCTTCAAGTGGGAGCGCGTGA RFP RFP CONTROL CDS
56 TRCN0000231688 CCTGCAGGACGGCGAGTTCAT RFP RFP CONTROL CDS
57 TRCN0000231724 CCGTAATGCAGAAGAAGACCA RFP RFP CONTROL CDS
58 TRCN0000231690 CGTAATGCAGAAGAAGACCAT RFP RFP CONTROL CDS
59 TRCN0000231696 GTAATGCAGAAGAAGACCATG RFP RFP CONTROL CDS
60 TRCN0000231687 TGCAGAAGAAGACCATGGGCT RFP RFP CONTROL CDS
61 TRCN0000231689 CTACAAGACCGACATCAAGCT RFP RFP CONTROL CDS
62 TRCN0000231692 CAACGAGGACTACACCATCGT RFP RFP CONTROL CDS
63 TRCN0000231725 ACTACACCATCGTGGAACAGT RFP RFP CONTROL CDS
64 TRCN0000231723 CTACACCATCGTGGAACAGTA RFP RFP CONTROL CDS
65 TRCN0000231701 TCAGTTCCAGTACGGCTCCAA RFP RFP CONTROL CDS
66 TRCN0000231691 GAACGGCCACGAGTTCGAGAT RFP RFP CONTROL CDS
67 TRCN0000231712 GCGATCGTAATCACCCGAGTG lacZ lacZ CONTROL CDS
68 TRCN0000231709 CGATCGTAATCACCCGAGTGT lacZ lacZ CONTROL CDS
69 TRCN0000231708 GCGCTAATCACGACGCGCTGT lacZ lacZ CONTROL CDS
70 TRCN0000231710 CGCTAAATACTGGCAGGCGTT lacZ lacZ CONTROL CDS
71 TRCN0000231706 GTCGGCTTACGGCGGTGATTT lacZ lacZ CONTROL CDS
72 TRCN0000231685 GTTCCGTCATAGCGATAACGA lacZ lacZ CONTROL CDS
73 TRCN0000231738 CCGTCATAGCGATAACGAGTT lacZ lacZ CONTROL CDS
74 TRCN0000231713 ACTCTGGCTAACGGTACGCGT lacZ lacZ CONTROL CDS
75 TRCN0000231704 GCGTTGGCAATTTAACCGCCA lacZ lacZ CONTROL CDS
76 TRCN0000231711 CCCGTCAGTATCGGCGGAATT lacZ lacZ CONTROL CDS
77 TRCN0000231700 GCCGTCGTATTACAACGTCGT lacZ lacZ CONTROL CDS
78 TRCN0000231717 CGTCGTATTACAACGTCGTGA lacZ lacZ CONTROL CDS
79 TRCN0000231702 TCGTATTACAACGTCGTGACT lacZ lacZ CONTROL CDS
80 TRCN0000231735 CCAACGTGACCTATCCCATTA lacZ lacZ CONTROL CDS
81 TRCN0000231716 CGACCACGCAAATCAGCGATT lacZ lacZ CONTROL CDS
82 TRCN0000231743 CGCGCCTTTCGGCGGTGAAAT lacZ lacZ CONTROL CDS
83 TRCN0000231726 TGTTCGCATTATCCGAACCAT lacZ lacZ CONTROL CDS
84 TRCN0000231722 CGCGATCGTAATCACCCGAGT lacZ lacZ CONTROL CDS
85 TRCN0000241923 (no hairpin) N/A N/A N/A
Download CSV