Transcript: Human NM_001293212.2

Homo sapiens tubulin beta class I (TUBB), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
TUBB (203068)
Length:
2661
CDS:
242..1636

Additional Resources:

NCBI RefSeq record:
NM_001293212.2
NBCI Gene record:
TUBB (203068)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001293212.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074361 GCAGTCACCTTCATTGGCAAT pLKO.1 1391 CDS 100% 4.050 5.670 N TUBB n/a
2 TRCN0000311653 GCAGTCACCTTCATTGGCAAT pLKO_005 1391 CDS 100% 4.050 5.670 N TUBB n/a
3 TRCN0000074359 CGCATCTCTGTGTACTACAAT pLKO.1 437 CDS 100% 5.625 3.938 N TUBB n/a
4 TRCN0000311722 CGCATCTCTGTGTACTACAAT pLKO_005 437 CDS 100% 5.625 3.938 N TUBB n/a
5 TRCN0000074362 AGAAGAATACCCTGATCGCAT pLKO.1 769 CDS 100% 2.640 1.848 N TUBB n/a
6 TRCN0000074358 GCGCTCAATAAATACTTGTTT pLKO.1 1791 3UTR 100% 5.625 3.375 N TUBB n/a
7 TRCN0000311723 GCGCTCAATAAATACTTGTTT pLKO_005 1791 3UTR 100% 5.625 3.375 N TUBB n/a
8 TRCN0000074360 GCAGATGCTTAACGTGCAGAA pLKO.1 1285 CDS 100% 4.050 2.430 N TUBB n/a
9 TRCN0000311652 GCAGATGCTTAACGTGCAGAA pLKO_005 1285 CDS 100% 4.050 2.430 N TUBB n/a
10 TRCN0000089932 GCAGAACAAGAACAGCAGCTA pLKO.1 1300 CDS 100% 2.640 1.320 Y Tubb2a n/a
11 TRCN0000089724 GACAACTTTGTATTTGGTCAA pLKO.1 563 CDS 100% 4.050 2.835 N Tubb4a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001293212.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05206 pDONR223 100% 94.1% 92.6% None (many diffs) n/a
2 ccsbBroad304_05206 pLX_304 0% 94.1% 92.6% V5 (many diffs) n/a
3 ccsbBroadEn_07109 pDONR223 100% 80% 88.1% None (many diffs) n/a
4 ccsbBroad304_07109 pLX_304 0% 80% 88.1% V5 (many diffs) n/a
5 TRCN0000470494 CAATTACAACATTCATCTATATAC pLX_317 29.5% 80% 88.1% V5 (many diffs) n/a
6 ccsbBroadEn_05511 pDONR223 100% 79.8% 88.6% None (many diffs) n/a
7 ccsbBroad304_05511 pLX_304 0% 79.8% 88.6% V5 (many diffs) n/a
8 TRCN0000478420 AGGACATGACATCGGGCAGTTTCG pLX_317 18.3% 79.8% 88.6% V5 (many diffs) n/a
9 ccsbBroadEn_07591 pDONR223 100% 79.7% 89.4% None (many diffs) n/a
10 ccsbBroad304_07591 pLX_304 0% 79.7% 89.4% V5 (many diffs) n/a
11 TRCN0000472336 CCGGAACAAGTAAACTGCTTATCA pLX_317 41.4% 79.7% 89.4% V5 (many diffs) n/a
12 ccsbBroadEn_02416 pDONR223 100% 79.6% 90.3% None (many diffs) n/a
13 ccsbBroad304_02416 pLX_304 0% 79.6% 90.3% V5 (many diffs) n/a
14 TRCN0000466709 TCTCGCAGGACAGTTCGGCCAACT pLX_317 32.4% 79.6% 90.3% V5 (many diffs) n/a
15 ccsbBroadEn_02415 pDONR223 100% 77.3% 84.4% None (many diffs) n/a
16 ccsbBroad304_02415 pLX_304 0% 77.3% 84.4% V5 (many diffs) n/a
17 TRCN0000469802 TTTCCTGATTTATTTGACTTAATT pLX_317 33.2% 77.3% 84.4% V5 (many diffs) n/a
18 TRCN0000488922 TAACTAAGCCACAGTTTAACTCGA pLX_317 26.8% 77.3% 84.4% V5 (not translated due to prior stop codon) (many diffs) n/a
19 ccsbBroadEn_04404 pDONR223 100% 75.9% 83.6% None (many diffs) n/a
20 ccsbBroad304_04404 pLX_304 0% 75.9% 83.6% V5 (many diffs) n/a
21 TRCN0000480164 TGTCGAGACCCGACGGGAATTTTT pLX_317 24.4% 75.9% 83.6% V5 (many diffs) n/a
22 ccsbBroadEn_13398 pDONR223 100% 26.7% 26.7% None 1_1020del n/a
23 ccsbBroad304_13398 pLX_304 0% 26.7% 26.7% V5 1_1020del n/a
24 TRCN0000466902 ACCACAGTACACCCTTGCTTCGCA pLX_317 100% 26.7% 26.7% V5 1_1020del n/a
Download CSV