Transcript: Human NM_006086.4

Homo sapiens tubulin beta 3 class III (TUBB3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
TUBB3 (10381)
Length:
1706
CDS:
61..1413

Additional Resources:

NCBI RefSeq record:
NM_006086.4
NBCI Gene record:
TUBB3 (10381)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006086.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416522 CCGAAGCCAGCAGTGTCTAAA pLKO_005 1455 3UTR 100% 13.200 18.480 N TUBB3 n/a
2 TRCN0000014203 CAGTATTTATGGCCTCGTCCT pLKO.1 1545 3UTR 100% 2.160 3.024 N TUBB3 n/a
3 TRCN0000014206 CGAGATGTACGAAGACGACGA pLKO.1 1362 CDS 100% 2.160 3.024 N TUBB3 n/a
4 TRCN0000425303 AGTATCCCGACCGCATCATGA pLKO_005 533 CDS 100% 4.950 3.465 N TUBB3 n/a
5 TRCN0000014205 CATCTCTTCAGGCCTGACAAT pLKO.1 307 CDS 100% 4.950 3.465 N TUBB3 n/a
6 TRCN0000014204 CGAGGCCTCTTCTCACAAGTA pLKO.1 216 CDS 100% 4.950 3.465 N TUBB3 n/a
7 TRCN0000429863 CAAGTTCTGGGAAGTCATCAG pLKO_005 114 CDS 100% 4.050 2.835 N TUBB3 n/a
8 TRCN0000413375 CTCAAGATGTCCTCCACCTTC pLKO_005 1141 CDS 100% 4.050 2.835 N TUBB3 n/a
9 TRCN0000417267 TGGAGCGGATCAGCGTCTACT pLKO_005 191 CDS 100% 1.650 1.155 N TUBB3 n/a
10 TRCN0000014207 GAGCGGAGTCACCACCTCCTT pLKO.1 759 CDS 100% 0.000 0.000 N TUBB3 n/a
11 TRCN0000238808 AGACCTACTGCATCGACAATG pLKO_005 653 CDS 100% 10.800 5.400 Y Tubb3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006086.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02415 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02415 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469802 TTTCCTGATTTATTTGACTTAATT pLX_317 33.2% 100% 100% V5 n/a
4 TRCN0000488922 TAACTAAGCCACAGTTTAACTCGA pLX_317 26.8% 100% 100% V5 (not translated due to prior stop codon) n/a
5 ccsbBroadEn_07109 pDONR223 100% 87.8% 91.1% None (many diffs) n/a
6 ccsbBroad304_07109 pLX_304 0% 87.8% 91.1% V5 (many diffs) n/a
7 TRCN0000470494 CAATTACAACATTCATCTATATAC pLX_317 29.5% 87.8% 91.1% V5 (many diffs) n/a
8 ccsbBroadEn_07591 pDONR223 100% 87.8% 90.8% None (many diffs) n/a
9 ccsbBroad304_07591 pLX_304 0% 87.8% 90.8% V5 (many diffs) n/a
10 TRCN0000472336 CCGGAACAAGTAAACTGCTTATCA pLX_317 41.4% 87.8% 90.8% V5 (many diffs) n/a
11 ccsbBroadEn_04404 pDONR223 100% 87.7% 91.5% None (many diffs) n/a
12 ccsbBroad304_04404 pLX_304 0% 87.7% 91.5% V5 (many diffs) n/a
13 TRCN0000480164 TGTCGAGACCCGACGGGAATTTTT pLX_317 24.4% 87.7% 91.5% V5 (many diffs) n/a
14 ccsbBroadEn_05511 pDONR223 100% 87.3% 91.3% None (many diffs) n/a
15 ccsbBroad304_05511 pLX_304 0% 87.3% 91.3% V5 (many diffs) n/a
16 TRCN0000478420 AGGACATGACATCGGGCAGTTTCG pLX_317 18.3% 87.3% 91.3% V5 (many diffs) n/a
17 ccsbBroadEn_02416 pDONR223 100% 84% 91.7% None (many diffs) n/a
18 ccsbBroad304_02416 pLX_304 0% 84% 91.7% V5 (many diffs) n/a
19 TRCN0000466709 TCTCGCAGGACAGTTCGGCCAACT pLX_317 32.4% 84% 91.7% V5 (many diffs) n/a
20 ccsbBroadEn_05206 pDONR223 100% 81.8% 91.3% None (many diffs) n/a
21 ccsbBroad304_05206 pLX_304 0% 81.8% 91.3% V5 (many diffs) n/a
22 ccsbBroadEn_13398 pDONR223 100% 23.5% 24.6% None (many diffs) n/a
23 ccsbBroad304_13398 pLX_304 0% 23.5% 24.6% V5 (many diffs) n/a
24 TRCN0000466902 ACCACAGTACACCCTTGCTTCGCA pLX_317 100% 23.5% 24.6% V5 (many diffs) n/a
Download CSV