Transcript: Mouse NM_009451.3

Mus musculus tubulin, beta 4A class IVA (Tubb4a), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Tubb4a (22153)
Length:
2246
CDS:
270..1604

Additional Resources:

NCBI RefSeq record:
NM_009451.3
NBCI Gene record:
Tubb4a (22153)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009451.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089723 GCTTCACCTTTAACTCCTAAA pLKO.1 1746 3UTR 100% 10.800 8.640 N Tubb4a n/a
2 TRCN0000089725 GTTTACGGAAGCAGAGAGCAA pLKO.1 1490 CDS 100% 2.640 2.112 N Tubb4a n/a
3 TRCN0000089726 GCCACAGGTGGAAACTATGTT pLKO.1 429 CDS 100% 5.625 3.938 N Tubb4a n/a
4 TRCN0000423739 CAGCACTCCTGAACCATTCTC pLKO_005 1902 3UTR 100% 4.950 3.465 N Tubb4a n/a
5 TRCN0000089727 CCACTTCTTCATGCCAGGATT pLKO.1 1058 CDS 100% 4.950 3.465 N Tubb4a n/a
6 TRCN0000420496 TCCACCTTCTTAGATCTTGAA pLKO_005 1851 3UTR 100% 4.950 3.465 N Tubb4a n/a
7 TRCN0000089724 GACAACTTTGTATTTGGTCAA pLKO.1 531 CDS 100% 4.050 2.835 N Tubb4a n/a
8 TRCN0000238808 AGACCTACTGCATCGACAATG pLKO_005 862 CDS 100% 10.800 5.400 Y Tubb3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009451.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07591 pDONR223 100% 87.8% 100% None (many diffs) n/a
2 ccsbBroad304_07591 pLX_304 0% 87.8% 100% V5 (many diffs) n/a
3 TRCN0000472336 CCGGAACAAGTAAACTGCTTATCA pLX_317 41.4% 87.8% 100% V5 (many diffs) n/a
4 ccsbBroadEn_07109 pDONR223 100% 84.6% 95% None (many diffs) n/a
5 ccsbBroad304_07109 pLX_304 0% 84.6% 95% V5 (many diffs) n/a
6 TRCN0000470494 CAATTACAACATTCATCTATATAC pLX_317 29.5% 84.6% 95% V5 (many diffs) n/a
7 ccsbBroadEn_05511 pDONR223 100% 84.5% 95.5% None (many diffs) n/a
8 ccsbBroad304_05511 pLX_304 0% 84.5% 95.5% V5 (many diffs) n/a
9 TRCN0000478420 AGGACATGACATCGGGCAGTTTCG pLX_317 18.3% 84.5% 95.5% V5 (many diffs) n/a
10 ccsbBroadEn_05206 pDONR223 100% 84.4% 96.4% None (many diffs) n/a
11 ccsbBroad304_05206 pLX_304 0% 84.4% 96.4% V5 (many diffs) n/a
12 ccsbBroadEn_02416 pDONR223 100% 83.9% 98.4% None (many diffs) n/a
13 ccsbBroad304_02416 pLX_304 0% 83.9% 98.4% V5 (many diffs) n/a
14 TRCN0000466709 TCTCGCAGGACAGTTCGGCCAACT pLX_317 32.4% 83.9% 98.4% V5 (many diffs) n/a
15 ccsbBroadEn_02415 pDONR223 100% 82.9% 90.8% None (many diffs) n/a
16 ccsbBroad304_02415 pLX_304 0% 82.9% 90.8% V5 (many diffs) n/a
17 TRCN0000469802 TTTCCTGATTTATTTGACTTAATT pLX_317 33.2% 82.9% 90.8% V5 (many diffs) n/a
18 TRCN0000488922 TAACTAAGCCACAGTTTAACTCGA pLX_317 26.8% 82.9% 90.8% V5 (not translated due to prior stop codon) (many diffs) n/a
19 ccsbBroadEn_04404 pDONR223 100% 82.1% 91.7% None (many diffs) n/a
20 ccsbBroad304_04404 pLX_304 0% 82.1% 91.7% V5 (many diffs) n/a
21 TRCN0000480164 TGTCGAGACCCGACGGGAATTTTT pLX_317 24.4% 82.1% 91.7% V5 (many diffs) n/a
22 ccsbBroadEn_13398 pDONR223 100% 24.4% 26.2% None (many diffs) n/a
23 ccsbBroad304_13398 pLX_304 0% 24.4% 26.2% V5 (many diffs) n/a
24 TRCN0000466902 ACCACAGTACACCCTTGCTTCGCA pLX_317 100% 24.4% 26.2% V5 (many diffs) n/a
Download CSV