Transcript: Mouse NM_023279.2

Mus musculus tubulin, beta 3 class III (Tubb3), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Tubb3 (22152)
Length:
1758
CDS:
43..1395

Additional Resources:

NCBI RefSeq record:
NM_023279.2
NBCI Gene record:
Tubb3 (22152)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023279.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233346 CCTAGATGTCGTGCGGAAAGA pLKO_005 390 CDS 100% 4.950 6.930 N Tubb3 n/a
2 TRCN0000090866 CGTGCGGAAAGAGTGTGAGAA pLKO.1 399 CDS 100% 4.950 6.930 N Tubb3 n/a
3 TRCN0000238807 GGTTAAAGTCCTTCAGTATTT pLKO_005 1528 3UTR 100% 13.200 10.560 N Tubb3 n/a
4 TRCN0000233344 TGGCGCCTTTGGACACCTATT pLKO_005 276 CDS 100% 10.800 8.640 N Tubb3 n/a
5 TRCN0000090864 AGGCCCGACAACTTTATCTTT pLKO.1 298 CDS 100% 5.625 4.500 N Tubb3 n/a
6 TRCN0000090865 CAGGCCCGACAACTTTATCTT pLKO.1 297 CDS 100% 5.625 3.938 N Tubb3 n/a
7 TRCN0000116926 GAGTAAGAACAGCAGCTACTT pLKO.1 1044 CDS 100% 4.950 3.465 N TUBB6 n/a
8 TRCN0000090867 CCAGAGTAAGAACAGCAGCTA pLKO.1 1041 CDS 100% 2.640 1.848 N Tubb3 n/a
9 TRCN0000233345 ACTGGGCCAAAGGGCACTATA pLKO_005 341 CDS 100% 13.200 7.920 N Tubb3 n/a
10 TRCN0000090863 CCTCTGTATTTATGTTGCTTA pLKO.1 1605 3UTR 100% 4.950 2.970 N Tubb3 n/a
11 TRCN0000238808 AGACCTACTGCATCGACAATG pLKO_005 635 CDS 100% 10.800 5.400 Y Tubb3 n/a
12 TRCN0000029134 GCAACATGAATGACCTGGTAT pLKO.1 1280 CDS 100% 4.950 2.475 Y TUBB4A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023279.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02415 pDONR223 100% 90.7% 99.7% None (many diffs) n/a
2 ccsbBroad304_02415 pLX_304 0% 90.7% 99.7% V5 (many diffs) n/a
3 TRCN0000469802 TTTCCTGATTTATTTGACTTAATT pLX_317 33.2% 90.7% 99.7% V5 (many diffs) n/a
4 TRCN0000488922 TAACTAAGCCACAGTTTAACTCGA pLX_317 26.8% 90.7% 99.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_04404 pDONR223 100% 85.8% 91.3% None (many diffs) n/a
6 ccsbBroad304_04404 pLX_304 0% 85.8% 91.3% V5 (many diffs) n/a
7 TRCN0000480164 TGTCGAGACCCGACGGGAATTTTT pLX_317 24.4% 85.8% 91.3% V5 (many diffs) n/a
8 ccsbBroadEn_07109 pDONR223 100% 83.9% 90.8% None (many diffs) n/a
9 ccsbBroad304_07109 pLX_304 0% 83.9% 90.8% V5 (many diffs) n/a
10 TRCN0000470494 CAATTACAACATTCATCTATATAC pLX_317 29.5% 83.9% 90.8% V5 (many diffs) n/a
11 ccsbBroadEn_02416 pDONR223 100% 83.9% 91.5% None (many diffs) n/a
12 ccsbBroad304_02416 pLX_304 0% 83.9% 91.5% V5 (many diffs) n/a
13 TRCN0000466709 TCTCGCAGGACAGTTCGGCCAACT pLX_317 32.4% 83.9% 91.5% V5 (many diffs) n/a
14 ccsbBroadEn_07591 pDONR223 100% 83.5% 90.6% None (many diffs) n/a
15 ccsbBroad304_07591 pLX_304 0% 83.5% 90.6% V5 (many diffs) n/a
16 TRCN0000472336 CCGGAACAAGTAAACTGCTTATCA pLX_317 41.4% 83.5% 90.6% V5 (many diffs) n/a
17 ccsbBroadEn_05511 pDONR223 100% 83.5% 91.1% None (many diffs) n/a
18 ccsbBroad304_05511 pLX_304 0% 83.5% 91.1% V5 (many diffs) n/a
19 TRCN0000478420 AGGACATGACATCGGGCAGTTTCG pLX_317 18.3% 83.5% 91.1% V5 (many diffs) n/a
20 ccsbBroadEn_05206 pDONR223 100% 82.9% 91.1% None (many diffs) n/a
21 ccsbBroad304_05206 pLX_304 0% 82.9% 91.1% V5 (many diffs) n/a
22 ccsbBroadEn_13398 pDONR223 100% 23.8% 24.4% None (many diffs) n/a
23 ccsbBroad304_13398 pLX_304 0% 23.8% 24.4% V5 (many diffs) n/a
24 TRCN0000466902 ACCACAGTACACCCTTGCTTCGCA pLX_317 100% 23.8% 24.4% V5 (many diffs) n/a
Download CSV